Incidental Mutation 'R4330:Hs3st5'
ID324569
Institutional Source Beutler Lab
Gene Symbol Hs3st5
Ensembl Gene ENSMUSG00000044499
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 5
SynonymsLOC382362, D930005L05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location36506814-36834397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36832730 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 87 (V87D)
Ref Sequence ENSEMBL: ENSMUSP00000129434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058738] [ENSMUST00000167191] [ENSMUST00000168572]
Predicted Effect probably benign
Transcript: ENSMUST00000058738
AA Change: V87D

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000060229
Gene: ENSMUSG00000044499
AA Change: V87D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167191
AA Change: V87D

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130778
Gene: ENSMUSG00000044499
AA Change: V87D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168572
AA Change: V87D

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129434
Gene: ENSMUSG00000044499
AA Change: V87D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HS3ST5 belongs to a group of heparan sulfate 3-O-sulfotransferases (EC 2.8.2.23) that transfer sulfate from 3-prime-phosphoadenosine 5-prime phosphosulfate (PAPS) to heparan sulfate and heparin (Mochizuki et al., 2003 [PubMed 12740361]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Hs3st5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Hs3st5 APN 10 36832922 missense probably benign 0.02
IGL00913:Hs3st5 APN 10 36832850 missense probably damaging 1.00
IGL01407:Hs3st5 APN 10 36833408 missense probably damaging 1.00
IGL01516:Hs3st5 APN 10 36833051 missense probably damaging 1.00
IGL02396:Hs3st5 APN 10 36828703 start codon destroyed probably benign 0.08
IGL03351:Hs3st5 APN 10 36833323 missense probably damaging 1.00
R0606:Hs3st5 UTSW 10 36832588 missense probably benign 0.00
R1412:Hs3st5 UTSW 10 36832676 missense probably benign 0.02
R1443:Hs3st5 UTSW 10 36833414 missense probably benign 0.35
R1493:Hs3st5 UTSW 10 36832874 missense probably damaging 1.00
R1768:Hs3st5 UTSW 10 36833169 missense probably benign 0.01
R1792:Hs3st5 UTSW 10 36832724 missense probably benign
R1991:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R1992:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R4610:Hs3st5 UTSW 10 36828806 missense probably benign 0.26
R5459:Hs3st5 UTSW 10 36828746 missense possibly damaging 0.85
R5561:Hs3st5 UTSW 10 36833429 missense probably damaging 1.00
R6005:Hs3st5 UTSW 10 36832928 missense probably damaging 1.00
R7082:Hs3st5 UTSW 10 36832837 missense probably benign 0.01
R7326:Hs3st5 UTSW 10 36833194 missense probably damaging 1.00
R7507:Hs3st5 UTSW 10 36833015 missense probably damaging 1.00
R7885:Hs3st5 UTSW 10 36828780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCATTTTGAGCCTGGCAC -3'
(R):5'- ATGCCGGGCTCTTTTCAATCG -3'

Sequencing Primer
(F):5'- GTGACAAGTTCTTTCTCTTTTGCTTG -3'
(R):5'- CTCTTTTCAATCGTGATTTGCTGAG -3'
Posted On2015-06-24