Incidental Mutation 'R4330:Scpep1'
ID324572
Institutional Source Beutler Lab
Gene Symbol Scpep1
Ensembl Gene ENSMUSG00000000278
Gene Nameserine carboxypeptidase 1
Synonyms4833411K15Rik, 2410018F01Rik, Risc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location88924020-88955465 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 88935903 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 236 (Q236*)
Ref Sequence ENSEMBL: ENSMUSP00000000287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000287]
Predicted Effect probably null
Transcript: ENSMUST00000000287
AA Change: Q236*
SMART Domains Protein: ENSMUSP00000000287
Gene: ENSMUSG00000000278
AA Change: Q236*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_S10 29 451 2e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139592
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit no abnormal phenotype. Mice homozygous for a knock-out allele exhibit abnormal blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Scpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Scpep1 APN 11 88952477 missense probably damaging 1.00
IGL01123:Scpep1 APN 11 88941328 missense possibly damaging 0.79
IGL02341:Scpep1 APN 11 88944488 missense probably benign 0.30
IGL03078:Scpep1 APN 11 88935831 missense possibly damaging 0.67
IGL03014:Scpep1 UTSW 11 88933445 splice site probably null
R1652:Scpep1 UTSW 11 88952434 nonsense probably null
R1966:Scpep1 UTSW 11 88952414 missense probably damaging 1.00
R4275:Scpep1 UTSW 11 88947142 splice site probably null
R4331:Scpep1 UTSW 11 88935903 nonsense probably null
R4360:Scpep1 UTSW 11 88930244 missense possibly damaging 0.78
R4502:Scpep1 UTSW 11 88944385 missense probably benign 0.00
R4885:Scpep1 UTSW 11 88935911 missense probably benign 0.20
R4896:Scpep1 UTSW 11 88941296 missense probably damaging 1.00
R5010:Scpep1 UTSW 11 88941349 missense probably benign 0.30
R5229:Scpep1 UTSW 11 88937045 missense probably damaging 1.00
R5899:Scpep1 UTSW 11 88934576 critical splice donor site probably null
R5999:Scpep1 UTSW 11 88929313 missense possibly damaging 0.85
R6975:Scpep1 UTSW 11 88947205 missense probably damaging 0.98
R7098:Scpep1 UTSW 11 88929185 missense possibly damaging 0.59
R7637:Scpep1 UTSW 11 88929220 missense probably damaging 1.00
R7790:Scpep1 UTSW 11 88933521 missense possibly damaging 0.70
R8285:Scpep1 UTSW 11 88952467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAATCTGTGGGAGAGTCAGG -3'
(R):5'- TCTCTGAGACTTCTGACAACACTC -3'

Sequencing Primer
(F):5'- TCAGGACAGGGCCAATCCTC -3'
(R):5'- CTGACAACACTCTTCTTAGGTAAGC -3'
Posted On2015-06-24