Incidental Mutation 'R4330:Rhbdf2'
ID324573
Institutional Source Beutler Lab
Gene Symbol Rhbdf2
Ensembl Gene ENSMUSG00000020806
Gene Namerhomboid 5 homolog 2
SynonymsiRhom2, Rhbdl6, 4732465I17Rik
Accession Numbers

VEGA: OTTMUST00000008766; MGI: 2442473

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116598165-116627019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116601956 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 413 (K413R)
Ref Sequence ENSEMBL: ENSMUSP00000099318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021160] [ENSMUST00000103028] [ENSMUST00000103029] [ENSMUST00000123507] [ENSMUST00000153476]
Predicted Effect probably benign
Transcript: ENSMUST00000021160
SMART Domains Protein: ENSMUSP00000021160
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
PDB:1KUY|A 3 104 1e-50 PDB
SCOP:d1cjwa_ 28 103 4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103028
AA Change: K413R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099317
Gene: ENSMUSG00000020806
AA Change: K413R

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 306 1.8e-98 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 4.6e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103029
AA Change: K413R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099318
Gene: ENSMUSG00000020806
AA Change: K413R

DomainStartEndE-ValueType
Pfam:Rhomboid_SP 98 304 4.7e-97 PFAM
transmembrane domain 376 398 N/A INTRINSIC
Pfam:Rhomboid 619 763 8.1e-31 PFAM
transmembrane domain 775 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123507
SMART Domains Protein: ENSMUSP00000115999
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
PDB:1IB1|H 3 53 6e-16 PDB
SCOP:d1cjwa_ 28 59 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142978
Predicted Effect probably benign
Transcript: ENSMUST00000153476
SMART Domains Protein: ENSMUSP00000122895
Gene: ENSMUSG00000020804

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 82 172 4.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display impaired TNF secretion and increased sensitivity to bacterial infection induced mortality. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted(4) Gene trapped(30)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Rhbdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rhbdf2 APN 11 116601751 missense possibly damaging 0.80
IGL01464:Rhbdf2 APN 11 116600908 missense probably benign 0.18
IGL02060:Rhbdf2 APN 11 116600626 missense probably damaging 1.00
IGL02211:Rhbdf2 APN 11 116600435 missense possibly damaging 0.49
Lostnf UTSW 11 116600161 missense probably damaging 1.00
Lostnf2 UTSW 11 116600191 missense possibly damaging 0.94
sinecure UTSW 11 116602260 missense probably damaging 0.99
Trapezoid UTSW 11 116601148 missense probably damaging 0.96
R0131:Rhbdf2 UTSW 11 116605344 missense probably damaging 1.00
R0399:Rhbdf2 UTSW 11 116603992 missense probably benign 0.00
R0739:Rhbdf2 UTSW 11 116600161 missense probably damaging 1.00
R1756:Rhbdf2 UTSW 11 116607266 missense probably benign
R1839:Rhbdf2 UTSW 11 116600191 missense possibly damaging 0.94
R2029:Rhbdf2 UTSW 11 116601148 missense probably damaging 0.96
R3833:Rhbdf2 UTSW 11 116604424 missense probably damaging 1.00
R4331:Rhbdf2 UTSW 11 116602296 missense probably damaging 1.00
R4872:Rhbdf2 UTSW 11 116601945 missense probably benign 0.04
R5530:Rhbdf2 UTSW 11 116600662 missense probably damaging 1.00
R5625:Rhbdf2 UTSW 11 116605377 missense probably damaging 0.99
R5841:Rhbdf2 UTSW 11 116602354 unclassified probably benign
R6579:Rhbdf2 UTSW 11 116604463 missense probably benign 0.02
R7047:Rhbdf2 UTSW 11 116603651 critical splice donor site probably null
R7403:Rhbdf2 UTSW 11 116600419 missense probably damaging 1.00
R7743:Rhbdf2 UTSW 11 116601601 missense probably benign 0.04
R7743:Rhbdf2 UTSW 11 116603949 missense probably benign
R7855:Rhbdf2 UTSW 11 116602240 nonsense probably null
R8055:Rhbdf2 UTSW 11 116607365 missense probably benign 0.01
X0027:Rhbdf2 UTSW 11 116599093 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGCTCCCAGGTGAATGAGG -3'
(R):5'- TGGCACCAAGTATCTCCCAC -3'

Sequencing Primer
(F):5'- CTCCCAGGTGAATGAGGTCAATCTG -3'
(R):5'- GTATCTCCCACCACAGTACCCTG -3'
Posted On2015-06-24