Incidental Mutation 'R4330:Jmy'
ID324575
Institutional Source Beutler Lab
Gene Symbol Jmy
Ensembl Gene ENSMUSG00000021690
Gene Namejunction-mediating and regulatory protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4330 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93430101-93499808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93499273 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 12 (D12Y)
Ref Sequence ENSEMBL: ENSMUSP00000070339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065537] [ENSMUST00000220513]
Predicted Effect probably damaging
Transcript: ENSMUST00000065537
AA Change: D12Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070339
Gene: ENSMUSG00000021690
AA Change: D12Y

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 55 6.2e-30 PFAM
low complexity region 77 94 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 152 181 N/A INTRINSIC
low complexity region 202 217 N/A INTRINSIC
Pfam:JMY 220 574 2.2e-175 PFAM
SCOP:d1jvr__ 794 816 4e-3 SMART
WH2 916 933 2.21e-2 SMART
low complexity region 964 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220513
AA Change: D12Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1757 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Rabl2 T C 15: 89,586,934 D66G probably benign Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Jmy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Jmy APN 13 93441402 missense probably benign 0.00
IGL00949:Jmy APN 13 93454002 missense probably damaging 1.00
IGL01111:Jmy APN 13 93441021 missense probably damaging 1.00
IGL01734:Jmy APN 13 93459651 missense probably damaging 1.00
IGL01926:Jmy APN 13 93459786 missense probably damaging 1.00
IGL01985:Jmy APN 13 93459636 missense possibly damaging 0.58
IGL02183:Jmy APN 13 93499242 missense possibly damaging 0.78
IGL02517:Jmy APN 13 93452808 missense probably benign 0.01
IGL02524:Jmy APN 13 93472760 missense probably damaging 1.00
IGL02697:Jmy APN 13 93459701 nonsense probably null
IGL03024:Jmy APN 13 93499199 missense probably damaging 1.00
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0722:Jmy UTSW 13 93452817 missense probably benign 0.37
R1533:Jmy UTSW 13 93441311 missense probably benign
R1667:Jmy UTSW 13 93498370 missense probably damaging 1.00
R1737:Jmy UTSW 13 93498795 missense probably damaging 0.99
R1815:Jmy UTSW 13 93454077 missense probably damaging 1.00
R2057:Jmy UTSW 13 93459703 missense probably damaging 1.00
R3522:Jmy UTSW 13 93454050 missense probably damaging 1.00
R3765:Jmy UTSW 13 93464711 missense possibly damaging 0.78
R4231:Jmy UTSW 13 93498925 missense probably benign
R4279:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4279:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4330:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4845:Jmy UTSW 13 93439738 missense possibly damaging 0.80
R5047:Jmy UTSW 13 93441572 missense possibly damaging 0.65
R5403:Jmy UTSW 13 93441396 missense probably benign 0.08
R5941:Jmy UTSW 13 93498825 missense probably benign
R5953:Jmy UTSW 13 93499116 missense possibly damaging 0.62
R6022:Jmy UTSW 13 93453578 splice site probably null
R6150:Jmy UTSW 13 93441133 missense probably benign 0.10
R6520:Jmy UTSW 13 93454039 missense probably benign 0.10
R7073:Jmy UTSW 13 93441333 missense probably benign 0.01
R7074:Jmy UTSW 13 93453931 missense probably benign 0.15
R7325:Jmy UTSW 13 93472743 missense probably damaging 0.99
R7575:Jmy UTSW 13 93464595 nonsense probably null
R7641:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7674:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7862:Jmy UTSW 13 93499195 missense possibly damaging 0.75
R8278:Jmy UTSW 13 93464716 missense probably damaging 1.00
R8416:Jmy UTSW 13 93498441 missense probably damaging 1.00
Z1088:Jmy UTSW 13 93441081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTTCCAGGACCTCGATC -3'
(R):5'- ACCATGTGAACTACCTGCTC -3'

Sequencing Primer
(F):5'- ATCTCGGGATTCGGCGCTTC -3'
(R):5'- TCTTCTGAGAGCCGCACCAC -3'
Posted On2015-06-24