Mutagenetix > Incidental Mutation

Incidental Mutation 'R4330:Rabl2'

324577

Institutional Source

Beutler Lab

Gene Symbol

Rabl2

Ensembl Gene

ENSMUSG00000022621

Gene Name

RAB, member RAS oncogene family-like 2

Synonyms

Rabl2a, 1110031N17Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4330 (G1)

Quality Score

176

Status

Not validated

Chromosome

Chromosomal Location

89466736-89476126 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89471137 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 66 (D66G)

Ref Sequence

ENSEMBL: ENSMUSP00000126182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023294] [ENSMUST00000094056] [ENSMUST00000169466] [ENSMUST00000170126] [ENSMUST00000172053] [ENSMUST00000171580]

AlphaFold

E9Q9D5

Predicted Effect

probably benign
Transcript: ENSMUST00000023294
AA Change: D66G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000023294
Gene: ENSMUSG00000022621
AA Change: D66G

Domain	Start	End	E-Value	Type
Pfam:Arf	10	196	2.3e-12	PFAM
Pfam:MMR_HSR1	23	134	1.4e-6	PFAM
Pfam:Roc	23	137	2e-35	PFAM
Pfam:Gtr1_RagA	23	171	9e-8	PFAM
Pfam:Ras	23	180	3.8e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000094056

SMART Domains

Protein: ENSMUSP00000091598
Gene: ENSMUSG00000022621

Domain	Start	End	E-Value	Type
Blast:RAB	50	94	4e-10	BLAST
SCOP:d3raba_	57	91	1e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165747

Predicted Effect

probably benign
Transcript: ENSMUST00000169466

SMART Domains

Protein: ENSMUSP00000129660
Gene: ENSMUSG00000022621

Domain	Start	End	E-Value	Type
SCOP:d1ek0a_	21	53	8e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170126
AA Change: D66G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000126182
Gene: ENSMUSG00000022621
AA Change: D66G

Domain	Start	End	E-Value	Type
Pfam:Ras	23	74	1.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171142

Predicted Effect

probably benign
Transcript: ENSMUST00000172053
AA Change: D66G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000129253
Gene: ENSMUSG00000022621
AA Change: D66G

Domain	Start	End	E-Value	Type
Pfam:Arf	10	100	6.5e-9	PFAM
Pfam:Miro	23	102	1.7e-11	PFAM
Pfam:Ras	23	102	4.5e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172074

Predicted Effect

probably benign
Transcript: ENSMUST00000171826

SMART Domains

Protein: ENSMUSP00000129221
Gene: ENSMUSG00000022621

Domain	Start	End	E-Value	Type
Blast:RAB	2	49	7e-16	BLAST
SCOP:d1fzqa_	3	49	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171580

SMART Domains

Protein: ENSMUSP00000128799
Gene: ENSMUSG00000022621

Domain	Start	End	E-Value	Type
SCOP:d1ek0a_	21	38	7e-5	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility, reduced testis weight, oligospermia, asthenozoospermia and short flagellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34l	T	A	8: 44,079,287 (GRCm39)	K312N	probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 117,721,122 (GRCm39)		probably benign	Het
Cdh10	G	A	15: 19,000,045 (GRCm39)	V497I	probably damaging	Het
Chd4	T	C	6: 125,078,565 (GRCm39)	V229A	probably benign	Het
Cnr2	T	A	4: 135,644,237 (GRCm39)	I105N	possibly damaging	Het
Dnai1	A	G	4: 41,637,966 (GRCm39)	T701A	probably damaging	Het
Eri1	G	A	8: 35,936,383 (GRCm39)	R313*	probably null	Het
Hrh3	T	C	2: 179,741,665 (GRCm39)		probably benign	Het
Hs3st5	T	A	10: 36,708,726 (GRCm39)	V87D	probably benign	Het
Jmy	G	C	13: 93,635,390 (GRCm39)	P142R	probably damaging	Het
Jmy	C	A	13: 93,635,781 (GRCm39)	D12Y	probably damaging	Het
Mfsd4a	A	C	1: 131,981,291 (GRCm39)	M320R	possibly damaging	Het
Myocd	A	T	11: 65,114,590 (GRCm39)	H49Q	probably benign	Het
Nlk	A	G	11: 78,481,774 (GRCm39)	I229T	possibly damaging	Het
Ramp1	C	T	1: 91,151,067 (GRCm39)	T144I	possibly damaging	Het
Rhbdf2	T	C	11: 116,492,782 (GRCm39)	K413R	probably benign	Het
Scpep1	G	A	11: 88,826,729 (GRCm39)	Q236*	probably null	Het
Stil	A	G	4: 114,862,176 (GRCm39)	R40G	probably damaging	Het
Syt7	T	C	19: 10,399,162 (GRCm39)	V86A	probably damaging	Het
Ubr2	A	T	17: 47,278,204 (GRCm39)	L711Q	probably null	Het
Vmn1r78	T	A	7: 11,886,386 (GRCm39)		probably null	Het
Zfp280d	C	T	9: 72,203,261 (GRCm39)	T3I	possibly damaging	Het
Zscan25	T	A	5: 145,227,361 (GRCm39)	F342I	probably damaging	Het

Other mutations in Rabl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Rabl2	APN	15	89,474,473 (GRCm39)	splice site	probably benign
IGL01612:Rabl2	APN	15	89,467,615 (GRCm39)	missense	probably benign	0.05
IGL02317:Rabl2	APN	15	89,468,492 (GRCm39)	missense	probably damaging	1.00
R0335:Rabl2	UTSW	15	89,468,169 (GRCm39)	missense	probably damaging	1.00
R4169:Rabl2	UTSW	15	89,474,582 (GRCm39)	start codon destroyed	probably null	0.98
R4276:Rabl2	UTSW	15	89,468,391 (GRCm39)	intron	probably benign
R5657:Rabl2	UTSW	15	89,472,416 (GRCm39)	missense	probably benign	0.00
R6242:Rabl2	UTSW	15	89,468,555 (GRCm39)	missense	probably benign
R9445:Rabl2	UTSW	15	89,468,148 (GRCm39)	missense	probably damaging	1.00
R9513:Rabl2	UTSW	15	89,474,631 (GRCm39)	critical splice acceptor site	probably null
R9516:Rabl2	UTSW	15	89,474,631 (GRCm39)	critical splice acceptor site	probably null
X0023:Rabl2	UTSW	15	89,468,183 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AAGGCCTCTGAGCTCCTTTC -3'
(R):5'- TGGAAAAGCTGTCTCACCC -3'

Sequencing Primer
(F):5'- GAGCTCCTTTCTCTCCAGCAGG -3'
(R):5'- CAGCCTGGTCTACATAGTGAGAC -3'

Posted On

2015-06-24