Incidental Mutation 'R4330:Rabl2'
ID324577
Institutional Source Beutler Lab
Gene Symbol Rabl2
Ensembl Gene ENSMUSG00000022621
Gene NameRAB, member RAS oncogene family-like 2
Synonyms1110031N17Rik, Rabl2a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4330 (G1)
Quality Score176
Status Not validated
Chromosome15
Chromosomal Location89582533-89591923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89586934 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 66 (D66G)
Ref Sequence ENSEMBL: ENSMUSP00000126182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023294] [ENSMUST00000094056] [ENSMUST00000169466] [ENSMUST00000170126] [ENSMUST00000171580] [ENSMUST00000172053]
Predicted Effect probably benign
Transcript: ENSMUST00000023294
AA Change: D66G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000023294
Gene: ENSMUSG00000022621
AA Change: D66G

DomainStartEndE-ValueType
Pfam:Arf 10 196 2.3e-12 PFAM
Pfam:MMR_HSR1 23 134 1.4e-6 PFAM
Pfam:Roc 23 137 2e-35 PFAM
Pfam:Gtr1_RagA 23 171 9e-8 PFAM
Pfam:Ras 23 180 3.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094056
SMART Domains Protein: ENSMUSP00000091598
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Blast:RAB 50 94 4e-10 BLAST
SCOP:d3raba_ 57 91 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165747
Predicted Effect probably benign
Transcript: ENSMUST00000169466
SMART Domains Protein: ENSMUSP00000129660
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 53 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170126
AA Change: D66G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126182
Gene: ENSMUSG00000022621
AA Change: D66G

DomainStartEndE-ValueType
Pfam:Ras 23 74 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171142
Predicted Effect probably benign
Transcript: ENSMUST00000171580
SMART Domains Protein: ENSMUSP00000128799
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
SCOP:d1ek0a_ 21 38 7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171826
SMART Domains Protein: ENSMUSP00000129221
Gene: ENSMUSG00000022621

DomainStartEndE-ValueType
Blast:RAB 2 49 7e-16 BLAST
SCOP:d1fzqa_ 3 49 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172053
AA Change: D66G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129253
Gene: ENSMUSG00000022621
AA Change: D66G

DomainStartEndE-ValueType
Pfam:Arf 10 100 6.5e-9 PFAM
Pfam:Miro 23 102 1.7e-11 PFAM
Pfam:Ras 23 102 4.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172074
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAB gene family which belongs to the RAS GTPase superfamily. The proteins in the family of RAS-related signaling molecules are small GTP-binding proteins that play important roles in the regulation of exocytotic and endocytotic pathways. This gene maps to the site of an ancestral telomere fusion event and may be a subtelomeric gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility, reduced testis weight, oligospermia, asthenozoospermia and short flagellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cdh10 G A 15: 18,999,959 V497I probably damaging Het
Chd4 T C 6: 125,101,602 V229A probably benign Het
Cnr2 T A 4: 135,916,926 I105N possibly damaging Het
Dnaic1 A G 4: 41,637,966 T701A probably damaging Het
Eri1 G A 8: 35,469,229 R313* probably null Het
Gm5346 T A 8: 43,626,250 K312N probably benign Het
Hrh3 T C 2: 180,099,872 probably benign Het
Hs3st5 T A 10: 36,832,730 V87D probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Mfsd4a A C 1: 132,053,553 M320R possibly damaging Het
Myocd A T 11: 65,223,764 H49Q probably benign Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Ramp1 C T 1: 91,223,345 T144I possibly damaging Het
Rhbdf2 T C 11: 116,601,956 K413R probably benign Het
Scpep1 G A 11: 88,935,903 Q236* probably null Het
Stil A G 4: 115,004,979 R40G probably damaging Het
Syt7 T C 19: 10,421,798 V86A probably damaging Het
Ubr2 A T 17: 46,967,278 L711Q probably null Het
Vmn1r78 T A 7: 12,152,459 probably null Het
Zfp280d C T 9: 72,295,979 T3I possibly damaging Het
Zscan25 T A 5: 145,290,551 F342I probably damaging Het
Other mutations in Rabl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Rabl2 APN 15 89590270 splice site probably benign
IGL01612:Rabl2 APN 15 89583412 missense probably benign 0.05
IGL02317:Rabl2 APN 15 89584289 missense probably damaging 1.00
R0335:Rabl2 UTSW 15 89583966 missense probably damaging 1.00
R4169:Rabl2 UTSW 15 89590379 start codon destroyed probably null 0.98
R4276:Rabl2 UTSW 15 89584188 intron probably benign
R5657:Rabl2 UTSW 15 89588213 missense probably benign 0.00
R6242:Rabl2 UTSW 15 89584352 missense probably benign
X0023:Rabl2 UTSW 15 89583980 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGGCCTCTGAGCTCCTTTC -3'
(R):5'- TGGAAAAGCTGTCTCACCC -3'

Sequencing Primer
(F):5'- GAGCTCCTTTCTCTCCAGCAGG -3'
(R):5'- CAGCCTGGTCTACATAGTGAGAC -3'
Posted On2015-06-24