Incidental Mutation 'R0010:Cdk5rap2'
ID32461
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
MMRRC Submission 038305-MU
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R0010 (G1)
Quality Score130
Status Validated (trace)
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70243459 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 270 (E270G)
Ref Sequence ENSEMBL: ENSMUSP00000116928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124251
Predicted Effect probably benign
Transcript: ENSMUST00000138561
AA Change: E270G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298
AA Change: E270G

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144099
AA Change: E1521G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: E1521G

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,205,609 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Bbs7 T C 3: 36,607,717 probably null Het
BC037034 T C 5: 138,260,293 probably null Het
Cacna1h T C 17: 25,380,844 K1566E probably damaging Het
Ccdc73 C T 2: 104,980,987 probably benign Het
Cd74 A T 18: 60,803,896 probably benign Het
Cd74 A T 18: 60,809,071 H124L probably benign Het
Ces2a G A 8: 104,741,396 D520N probably benign Het
Cldnd1 T A 16: 58,731,259 probably benign Het
Cox17 T A 16: 38,347,170 C24S possibly damaging Het
Cyp2b9 T A 7: 26,186,753 probably benign Het
Dennd4a T C 9: 64,896,715 L1112P probably benign Het
Dennd4c T C 4: 86,781,577 S222P probably damaging Het
Dhx37 T A 5: 125,431,616 Q85L probably benign Het
Egfem1 G T 3: 29,582,919 C192F probably damaging Het
Eif3f A T 7: 108,941,005 N336Y possibly damaging Het
Evc2 T A 5: 37,417,449 L1016Q probably damaging Het
Fam114a2 G T 11: 57,514,156 T40N probably damaging Het
Fam135b T C 15: 71,622,032 K16R probably damaging Het
Fcho1 A G 8: 71,709,999 Y725H probably damaging Het
Frem1 T C 4: 83,000,098 I536V probably benign Het
Ginm1 T C 10: 7,775,374 probably benign Het
Glrb A T 3: 80,860,315 probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10320 T C 13: 98,489,546 Y110C probably damaging Het
Gm20388 G A 8: 122,270,598 probably benign Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm5422 A G 10: 31,249,754 noncoding transcript Het
Igkv6-29 A T 6: 70,138,770 probably benign Het
Inpp5d G A 1: 87,697,546 probably null Het
Itpr3 T G 17: 27,120,977 V2610G probably damaging Het
Kmt5c T A 7: 4,746,208 M88K probably benign Het
Lrp12 C T 15: 39,878,276 A367T probably damaging Het
Ltbp1 A G 17: 75,363,391 T1476A probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Milr1 T G 11: 106,767,003 *209G probably null Het
Mitf A G 6: 97,807,281 K33R probably benign Het
Mon2 A C 10: 123,032,694 S485A probably damaging Het
Mpdu1 C T 11: 69,658,841 G47R probably damaging Het
Ms4a4d A G 19: 11,554,826 N112S probably damaging Het
Mybpc3 G A 2: 91,134,833 W1082* probably null Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Naa15 A T 3: 51,436,213 probably null Het
Nav3 A G 10: 109,823,226 probably benign Het
Nek7 T A 1: 138,544,204 Q66L possibly damaging Het
Nktr G A 9: 121,741,166 probably benign Het
Nlgn1 G T 3: 25,435,842 probably benign Het
Npr1 T C 3: 90,454,832 E1002G probably damaging Het
Nup133 A T 8: 123,904,579 I1072N probably damaging Het
Oc90 C T 15: 65,876,548 C371Y probably damaging Het
Olfr835 A T 9: 19,035,322 L66F probably damaging Het
Olfr901 A T 9: 38,430,920 I213F possibly damaging Het
Olfr994 A T 2: 85,429,895 D311E probably benign Het
Pradc1 A T 6: 85,447,231 N44K probably damaging Het
Pradc1 T C 6: 85,447,620 D116G probably damaging Het
Ptprk G A 10: 28,585,969 C91Y probably damaging Het
Pus7 T C 5: 23,747,845 I491V probably benign Het
Rock1 T A 18: 10,084,380 D951V probably damaging Het
Scgb2b26 T A 7: 33,944,349 E55D probably damaging Het
Scn8a T C 15: 101,013,573 V958A probably damaging Het
Sec14l1 T C 11: 117,143,770 probably benign Het
Sec24c A G 14: 20,689,261 probably benign Het
Sema6b C T 17: 56,124,105 E853K probably benign Het
Sgk1 G A 10: 21,997,438 probably null Het
Shprh C T 10: 11,151,931 T94I probably benign Het
Slc16a3 T C 11: 120,956,705 S240P probably benign Het
Slc5a8 T C 10: 88,886,590 V95A probably benign Het
Smg1 A T 7: 118,171,859 probably benign Het
Spta1 G A 1: 174,217,943 V1556I probably benign Het
Svs1 A T 6: 48,988,906 H616L probably damaging Het
Trappc4 G A 9: 44,405,231 probably benign Het
Tubgcp6 A G 15: 89,103,183 S1188P probably benign Het
Txlna T G 4: 129,629,086 D487A probably benign Het
Ube2d2b T C 5: 107,830,636 F51S possibly damaging Het
Vmn2r6 G A 3: 64,559,545 Q178* probably null Het
Wdfy3 T C 5: 101,848,349 T3234A probably damaging Het
Ylpm1 C A 12: 85,029,026 Q384K probably damaging Het
Zbtb41 T G 1: 139,423,530 V127G probably damaging Het
Zfp605 T A 5: 110,127,534 C173S probably benign Het
Zfp608 A T 18: 54,895,214 probably benign Het
Zhx2 T C 15: 57,821,274 V13A possibly damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACCTTCTCGTTCAGCACAG -3'
(R):5'- GGAATGCCAGAACCATCAATGCCAG -3'

Sequencing Primer
(F):5'- GATAGTTTCAGCTCACACATGC -3'
(R):5'- TACCAGTGTAATAAGGTTGGAAAAC -3'
Posted On2013-05-09