Mutagenetix > Incidental Mutations

Incidental Mutation 'R4357:Eef2'

324619

Institutional Source

Beutler Lab

Gene Symbol

Eef2

Ensembl Gene

ENSMUSG00000034994

Gene Name

eukaryotic translation elongation factor 2

Synonyms

Ef-2

MMRRC Submission

041109-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R4357 (G1)

Quality Score

134

Status

Not validated

Chromosome

Chromosomal Location

81176631-81182498 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCCC to GCCCC at 81178767 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]

Predicted Effect

probably benign
Transcript: ENSMUST00000047665

SMART Domains

Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047864

SMART Domains

Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	360	2e-65	PFAM
Pfam:MMR_HSR1	21	159	6.3e-6	PFAM
Pfam:GTP_EFTU_D2	409	486	2.3e-14	PFAM
Pfam:EFG_II	501	568	1.9e-14	PFAM
EFG_IV	621	737	5.56e-27	SMART
EFG_C	739	828	4.06e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000056086

SMART Domains

Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082507

Predicted Effect

probably benign
Transcript: ENSMUST00000178422

SMART Domains

Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217936

Predicted Effect

probably benign
Transcript: ENSMUST00000218157

Predicted Effect

probably benign
Transcript: ENSMUST00000219133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220076

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	T	C	6: 50,574,210	T420A	probably benign	Het
4930432K21Rik	T	C	8: 84,159,592	L59P	probably benign	Het
Adam20	A	G	8: 40,795,047	T65A	possibly damaging	Het
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
Ap4m1	A	G	5: 138,173,049	E125G	probably damaging	Het
Atp13a2	C	A	4: 141,001,904	D599E	probably benign	Het
Camkv	G	A	9: 107,947,946	G354E	probably benign	Het
Casp8ap2	T	A	4: 32,646,150	M1741K	probably benign	Het
Chtf18	T	C	17: 25,719,132	D119G	probably benign	Het
Cnga1	T	A	5: 72,618,252	D42V	probably damaging	Het
Cysltr2	T	C	14: 73,029,644	I209V	probably benign	Het
Defa27	A	T	8: 21,315,592	Q16L	probably null	Het
Dnaja3	T	C	16: 4,699,867	I321T	probably damaging	Het
Eif2ak3	T	A	6: 70,884,875	I467N	probably damaging	Het
Eif5b	T	A	1: 38,050,258	V1105E	probably damaging	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Gm10803	A	G	2: 93,564,005	R41G	unknown	Het
Gm38392	A	T	3: 88,247,434	I221N	probably damaging	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Hsd17b6	G	T	10: 127,993,768		probably null	Het
Ids	C	A	X: 70,346,344	G506C	probably damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
Lats2	A	G	14: 57,699,383	S550P	probably damaging	Het
Lmo7	A	G	14: 101,887,655	R406G	probably null	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Lrrfip2	A	G	9: 111,199,687	E326G	probably damaging	Het
Megf8	T	A	7: 25,355,749	I1969N	probably benign	Het
Mib1	A	G	18: 10,751,844	N242S	probably benign	Het
Ngf	A	G	3: 102,520,205	E94G	probably benign	Het
Oas2	C	T	5: 120,738,669		probably null	Het
Odf2	A	G	2: 29,892,244	T75A	probably benign	Het
Olfr1131	T	A	2: 87,628,466	M1K	probably null	Het
Olfr1313	A	G	2: 112,072,238	L115P	probably damaging	Het
Pi4ka	T	A	16: 17,367,439	I266F	probably benign	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Psmd2	T	G	16: 20,656,652	D393E	probably benign	Het
Rabep2	A	G	7: 126,448,225	I753T	probably damaging	Het
Rara	A	C	11: 98,968,111	I129L	probably damaging	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Sptlc1	A	T	13: 53,374,032	I32K	probably damaging	Het
Srd5a3	T	A	5: 76,147,700	F79Y	probably damaging	Het
Ssrp1	A	T	2: 85,041,151	M306L	probably benign	Het
Sulf2	T	C	2: 166,077,577	E817G	probably benign	Het
Tiam2	C	A	17: 3,450,853	D922E	probably damaging	Het
Tle4	A	G	19: 14,468,261	V207A	probably benign	Het
Ttll12	A	T	15: 83,581,757	C413S	probably damaging	Het
Usp45	T	A	4: 21,834,350	Y809*	probably null	Het
Vmn2r59	G	A	7: 42,012,220	P724S	probably damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het

Other mutations in Eef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01303:Eef2	APN	10	81181943	missense	possibly damaging	0.93
IGL01303:Eef2	APN	10	81181982	unclassified	probably null
IGL01376:Eef2	APN	10	81178049	unclassified	probably benign
IGL01876:Eef2	APN	10	81180270	missense	probably benign
IGL02000:Eef2	APN	10	81180011	missense	probably benign	0.13
IGL02514:Eef2	APN	10	81179593	missense	probably benign	0.11
IGL03087:Eef2	APN	10	81181247	missense	probably benign	0.12
IGL03389:Eef2	APN	10	81179706	missense	probably benign	0.40
fig	UTSW	10	81180292	missense	possibly damaging	0.50
R0052:Eef2	UTSW	10	81178768	frame shift	probably null
R0178:Eef2	UTSW	10	81180292	missense	possibly damaging	0.50
R0445:Eef2	UTSW	10	81178770	frame shift	probably null
R0497:Eef2	UTSW	10	81181586	missense	probably benign	0.00
R0539:Eef2	UTSW	10	81178768	frame shift	probably null
R0745:Eef2	UTSW	10	81181996	missense	probably benign	0.00
R0811:Eef2	UTSW	10	81178769	frame shift	probably null
R0812:Eef2	UTSW	10	81178769	frame shift	probably null
R0832:Eef2	UTSW	10	81178769	frame shift	probably null
R1136:Eef2	UTSW	10	81178769	frame shift	probably null
R1298:Eef2	UTSW	10	81178768	frame shift	probably null
R1549:Eef2	UTSW	10	81178768	frame shift	probably null
R1550:Eef2	UTSW	10	81180847	missense	probably benign	0.04
R2869:Eef2	UTSW	10	81178767	frame shift	probably null
R2870:Eef2	UTSW	10	81178767	frame shift	probably null
R2871:Eef2	UTSW	10	81178767	frame shift	probably null
R2872:Eef2	UTSW	10	81178767	frame shift	probably null
R3408:Eef2	UTSW	10	81178767	frame shift	probably null
R3414:Eef2	UTSW	10	81177858	missense	probably damaging	0.98
R4291:Eef2	UTSW	10	81179580	missense	probably benign	0.00
R4433:Eef2	UTSW	10	81178768	frame shift	probably null
R4577:Eef2	UTSW	10	81178767	frame shift	probably null
R5154:Eef2	UTSW	10	81178767	frame shift	probably null
R5609:Eef2	UTSW	10	81178769	frame shift	probably null
R6545:Eef2	UTSW	10	81181114	missense	probably damaging	1.00
R6649:Eef2	UTSW	10	81178768	frame shift	probably null
R6650:Eef2	UTSW	10	81178768	frame shift	probably null
R7326:Eef2	UTSW	10	81181282	missense	probably benign	0.26
R7472:Eef2	UTSW	10	81179550	missense	probably benign	0.01
R7579:Eef2	UTSW	10	81178768	frame shift	probably null
R8013:Eef2	UTSW	10	81178196	missense	probably damaging	1.00
Z1088:Eef2	UTSW	10	81181889	missense	probably damaging	1.00
Z1176:Eef2	UTSW	10	81181158	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTTGGAGAGTGCTTGTGTAC -3'
(R):5'- TCATGGTGGGTCAGAGATTCC -3'

Sequencing Primer
(F):5'- CAAAACATACGTGGTCTTCAGG -3'
(R):5'- TCAGAGATTCCCAGGGAGC -3'

Posted On

2015-06-24