Incidental Mutation 'R4357:Eef2'
ID324619
Institutional Source Beutler Lab
Gene Symbol Eef2
Ensembl Gene ENSMUSG00000034994
Gene Nameeukaryotic translation elongation factor 2
SynonymsEf-2
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R4357 (G1)
Quality Score134
Status Not validated
Chromosome10
Chromosomal Location81176631-81182498 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCC to GCCCC at 81178767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133]
Predicted Effect probably benign
Transcript: ENSMUST00000047665
SMART Domains Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047864
SMART Domains Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 360 2e-65 PFAM
Pfam:MMR_HSR1 21 159 6.3e-6 PFAM
Pfam:GTP_EFTU_D2 409 486 2.3e-14 PFAM
Pfam:EFG_II 501 568 1.9e-14 PFAM
EFG_IV 621 737 5.56e-27 SMART
EFG_C 739 828 4.06e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056086
SMART Domains Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082507
Predicted Effect probably benign
Transcript: ENSMUST00000178422
SMART Domains Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

DomainStartEndE-ValueType
S_TKc 13 275 1.93e-98 SMART
low complexity region 288 299 N/A INTRINSIC
low complexity region 331 347 N/A INTRINSIC
low complexity region 349 411 N/A INTRINSIC
coiled coil region 419 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217936
Predicted Effect probably benign
Transcript: ENSMUST00000218157
Predicted Effect probably benign
Transcript: ENSMUST00000219133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,210 T420A probably benign Het
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ap4m1 A G 5: 138,173,049 E125G probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Chtf18 T C 17: 25,719,132 D119G probably benign Het
Cnga1 T A 5: 72,618,252 D42V probably damaging Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rara A C 11: 98,968,111 I129L probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sptlc1 A T 13: 53,374,032 I32K probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Eef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Eef2 APN 10 81181943 missense possibly damaging 0.93
IGL01303:Eef2 APN 10 81181982 unclassified probably null
IGL01376:Eef2 APN 10 81178049 unclassified probably benign
IGL01876:Eef2 APN 10 81180270 missense probably benign
IGL02000:Eef2 APN 10 81180011 missense probably benign 0.13
IGL02514:Eef2 APN 10 81179593 missense probably benign 0.11
IGL03087:Eef2 APN 10 81181247 missense probably benign 0.12
IGL03389:Eef2 APN 10 81179706 missense probably benign 0.40
fig UTSW 10 81180292 missense possibly damaging 0.50
R0052:Eef2 UTSW 10 81178768 frame shift probably null
R0178:Eef2 UTSW 10 81180292 missense possibly damaging 0.50
R0445:Eef2 UTSW 10 81178770 frame shift probably null
R0497:Eef2 UTSW 10 81181586 missense probably benign 0.00
R0539:Eef2 UTSW 10 81178768 frame shift probably null
R0745:Eef2 UTSW 10 81181996 missense probably benign 0.00
R0811:Eef2 UTSW 10 81178769 frame shift probably null
R0812:Eef2 UTSW 10 81178769 frame shift probably null
R0832:Eef2 UTSW 10 81178769 frame shift probably null
R1136:Eef2 UTSW 10 81178769 frame shift probably null
R1298:Eef2 UTSW 10 81178768 frame shift probably null
R1549:Eef2 UTSW 10 81178768 frame shift probably null
R1550:Eef2 UTSW 10 81180847 missense probably benign 0.04
R2869:Eef2 UTSW 10 81178767 frame shift probably null
R2870:Eef2 UTSW 10 81178767 frame shift probably null
R2871:Eef2 UTSW 10 81178767 frame shift probably null
R2872:Eef2 UTSW 10 81178767 frame shift probably null
R3408:Eef2 UTSW 10 81178767 frame shift probably null
R3414:Eef2 UTSW 10 81177858 missense probably damaging 0.98
R4291:Eef2 UTSW 10 81179580 missense probably benign 0.00
R4433:Eef2 UTSW 10 81178768 frame shift probably null
R4577:Eef2 UTSW 10 81178767 frame shift probably null
R5154:Eef2 UTSW 10 81178767 frame shift probably null
R5609:Eef2 UTSW 10 81178769 frame shift probably null
R6545:Eef2 UTSW 10 81181114 missense probably damaging 1.00
R6649:Eef2 UTSW 10 81178768 frame shift probably null
R6650:Eef2 UTSW 10 81178768 frame shift probably null
R7326:Eef2 UTSW 10 81181282 missense probably benign 0.26
R7472:Eef2 UTSW 10 81179550 missense probably benign 0.01
R7579:Eef2 UTSW 10 81178768 frame shift probably null
R8013:Eef2 UTSW 10 81178196 missense probably damaging 1.00
Z1088:Eef2 UTSW 10 81181889 missense probably damaging 1.00
Z1176:Eef2 UTSW 10 81181158 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTTGGAGAGTGCTTGTGTAC -3'
(R):5'- TCATGGTGGGTCAGAGATTCC -3'

Sequencing Primer
(F):5'- CAAAACATACGTGGTCTTCAGG -3'
(R):5'- TCAGAGATTCCCAGGGAGC -3'
Posted On2015-06-24