Incidental Mutation 'R4357:Rara'
ID324622
Institutional Source Beutler Lab
Gene Symbol Rara
Ensembl Gene ENSMUSG00000037992
Gene Nameretinoic acid receptor, alpha
SynonymsRAR alpha 1, RARalpha1
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4357 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98927818-98974942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98968111 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 129 (I129L)
Ref Sequence ENSEMBL: ENSMUSP00000103097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068133] [ENSMUST00000107473] [ENSMUST00000107474] [ENSMUST00000107475] [ENSMUST00000164748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068133
AA Change: I132L

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069744
Gene: ENSMUSG00000037992
AA Change: I132L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107473
AA Change: I129L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103097
Gene: ENSMUSG00000037992
AA Change: I129L

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
ZnF_C4 82 153 7.53e-40 SMART
HOLI 227 385 1.22e-34 SMART
low complexity region 422 433 N/A INTRINSIC
low complexity region 436 459 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107474
AA Change: I132L

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103098
Gene: ENSMUSG00000037992
AA Change: I132L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107475
AA Change: I132L

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103099
Gene: ENSMUSG00000037992
AA Change: I132L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164748
AA Change: I132L

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129791
Gene: ENSMUSG00000037992
AA Change: I132L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
ZnF_C4 85 156 7.53e-40 SMART
HOLI 230 388 1.22e-34 SMART
low complexity region 425 436 N/A INTRINSIC
low complexity region 439 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for targeted null mutations show high neonatal mortality due to maternal cannibalization, failure to thrive, and excess mortality during the postnatal period. Male survivors exhibit testicular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,210 T420A probably benign Het
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ap4m1 A G 5: 138,173,049 E125G probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Chtf18 T C 17: 25,719,132 D119G probably benign Het
Cnga1 T A 5: 72,618,252 D42V probably damaging Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sptlc1 A T 13: 53,374,032 I32K probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Rara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Rara APN 11 98968166 missense probably benign 0.00
IGL01155:Rara APN 11 98968184 missense possibly damaging 0.92
IGL02141:Rara APN 11 98968081 missense probably damaging 1.00
IGL03194:Rara APN 11 98971664 missense possibly damaging 0.96
PIT4486001:Rara UTSW 11 98973495 missense possibly damaging 0.88
R0626:Rara UTSW 11 98971580 critical splice acceptor site probably null
R1973:Rara UTSW 11 98971670 missense possibly damaging 0.91
R3975:Rara UTSW 11 98970569 missense probably damaging 1.00
R5102:Rara UTSW 11 98966359 missense possibly damaging 0.80
R5147:Rara UTSW 11 98950724 missense probably benign 0.35
R5381:Rara UTSW 11 98971584 missense possibly damaging 0.93
R5570:Rara UTSW 11 98972652 missense probably damaging 1.00
R5861:Rara UTSW 11 98968161 nonsense probably null
R6273:Rara UTSW 11 98970222 missense probably benign 0.00
R6404:Rara UTSW 11 98961013 missense probably benign 0.16
R8906:Rara UTSW 11 98970163 missense probably damaging 1.00
R8921:Rara UTSW 11 98973626 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCAAAAGAGTCATCCTCCCC -3'
(R):5'- CTTAACTAGAAGCTTGCCCGC -3'

Sequencing Primer
(F):5'- AAAAGAGTCATCCTCCCCCATTTTTC -3'
(R):5'- TGTTCCCACATGTATACACAGG -3'
Posted On2015-06-24