Incidental Mutation 'R4357:Sptlc1'
ID324623
Institutional Source Beutler Lab
Gene Symbol Sptlc1
Ensembl Gene ENSMUSG00000021468
Gene Nameserine palmitoyltransferase, long chain base subunit 1
SynonymsLcb1
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4357 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location53332748-53377397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53374032 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 32 (I32K)
Ref Sequence ENSEMBL: ENSMUSP00000021920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021920]
Predicted Effect probably damaging
Transcript: ENSMUST00000021920
AA Change: I32K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021920
Gene: ENSMUSG00000021468
AA Change: I32K

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
Pfam:Aminotran_1_2 98 464 9.5e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221709
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a knock-out allele exhibit abnormal sphingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,210 T420A probably benign Het
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ap4m1 A G 5: 138,173,049 E125G probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Chtf18 T C 17: 25,719,132 D119G probably benign Het
Cnga1 T A 5: 72,618,252 D42V probably damaging Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rara A C 11: 98,968,111 I129L probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Sptlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Sptlc1 APN 13 53367378 missense probably damaging 0.98
IGL01354:Sptlc1 APN 13 53333951 missense probably benign
IGL01773:Sptlc1 APN 13 53377298 missense probably damaging 0.96
IGL01876:Sptlc1 APN 13 53374012 missense probably benign 0.02
R0390:Sptlc1 UTSW 13 53337612 missense probably benign 0.06
R1371:Sptlc1 UTSW 13 53351624 missense probably benign
R1961:Sptlc1 UTSW 13 53358880 missense probably benign
R2179:Sptlc1 UTSW 13 53351639 missense probably damaging 1.00
R2513:Sptlc1 UTSW 13 53337640 missense possibly damaging 0.61
R4989:Sptlc1 UTSW 13 53351656 missense probably damaging 0.97
R5055:Sptlc1 UTSW 13 53342182 missense probably benign 0.02
R6415:Sptlc1 UTSW 13 53351692 critical splice acceptor site probably null
R6752:Sptlc1 UTSW 13 53335358 missense possibly damaging 0.67
R7283:Sptlc1 UTSW 13 53344878 missense probably benign 0.03
R7548:Sptlc1 UTSW 13 53367932 missense possibly damaging 0.84
R7731:Sptlc1 UTSW 13 53333957 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGCTCACACGTCTACTCTG -3'
(R):5'- TTGAGAGCCATTGAGGAAGC -3'

Sequencing Primer
(F):5'- TGACACTTCGTACCCCCAG -3'
(R):5'- AGCCATTGAGGAAGCTCTGGC -3'
Posted On2015-06-24