Incidental Mutation 'R4357:Chtf18'
ID324636
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
MMRRC Submission 041109-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R4357 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25719132 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 119 (D119G)
Ref Sequence ENSEMBL: ENSMUSP00000131349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048054] [ENSMUST00000115108] [ENSMUST00000167940] [ENSMUST00000170575] [ENSMUST00000172002]
Predicted Effect probably benign
Transcript: ENSMUST00000048054
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115108
SMART Domains Protein: ENSMUSP00000110760
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167940
AA Change: D119G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214
AA Change: D119G

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168914
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170575
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172002
SMART Domains Protein: ENSMUSP00000131648
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik T C 6: 50,574,210 T420A probably benign Het
4930432K21Rik T C 8: 84,159,592 L59P probably benign Het
Adam20 A G 8: 40,795,047 T65A possibly damaging Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Ap4m1 A G 5: 138,173,049 E125G probably damaging Het
Atp13a2 C A 4: 141,001,904 D599E probably benign Het
Camkv G A 9: 107,947,946 G354E probably benign Het
Casp8ap2 T A 4: 32,646,150 M1741K probably benign Het
Cnga1 T A 5: 72,618,252 D42V probably damaging Het
Cysltr2 T C 14: 73,029,644 I209V probably benign Het
Defa27 A T 8: 21,315,592 Q16L probably null Het
Dnaja3 T C 16: 4,699,867 I321T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif2ak3 T A 6: 70,884,875 I467N probably damaging Het
Eif5b T A 1: 38,050,258 V1105E probably damaging Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm10803 A G 2: 93,564,005 R41G unknown Het
Gm38392 A T 3: 88,247,434 I221N probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hsd17b6 G T 10: 127,993,768 probably null Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Lats2 A G 14: 57,699,383 S550P probably damaging Het
Lmo7 A G 14: 101,887,655 R406G probably null Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrfip2 A G 9: 111,199,687 E326G probably damaging Het
Megf8 T A 7: 25,355,749 I1969N probably benign Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Ngf A G 3: 102,520,205 E94G probably benign Het
Oas2 C T 5: 120,738,669 probably null Het
Odf2 A G 2: 29,892,244 T75A probably benign Het
Olfr1131 T A 2: 87,628,466 M1K probably null Het
Olfr1313 A G 2: 112,072,238 L115P probably damaging Het
Pi4ka T A 16: 17,367,439 I266F probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd2 T G 16: 20,656,652 D393E probably benign Het
Rabep2 A G 7: 126,448,225 I753T probably damaging Het
Rara A C 11: 98,968,111 I129L probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Sptlc1 A T 13: 53,374,032 I32K probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Ssrp1 A T 2: 85,041,151 M306L probably benign Het
Sulf2 T C 2: 166,077,577 E817G probably benign Het
Tiam2 C A 17: 3,450,853 D922E probably damaging Het
Tle4 A G 19: 14,468,261 V207A probably benign Het
Ttll12 A T 15: 83,581,757 C413S probably damaging Het
Usp45 T A 4: 21,834,350 Y809* probably null Het
Vmn2r59 G A 7: 42,012,220 P724S probably damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1122:Chtf18 UTSW 17 25724623 missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25719194 missense probably damaging 0.98
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R4975:Chtf18 UTSW 17 25724566 missense possibly damaging 0.72
R5154:Chtf18 UTSW 17 25723720 missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25721244 missense probably benign 0.01
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25719989 missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25722275 splice site probably null
R7729:Chtf18 UTSW 17 25723517 missense probably damaging 1.00
R7939:Chtf18 UTSW 17 25722137 missense probably damaging 0.99
R8007:Chtf18 UTSW 17 25725534 missense probably damaging 0.96
R8051:Chtf18 UTSW 17 25723479 missense probably benign 0.05
R8296:Chtf18 UTSW 17 25722191 missense probably benign 0.00
R8321:Chtf18 UTSW 17 25720891 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACAGGCTTCTCAAGTGGATTG -3'
(R):5'- CAGAGGTGTGTATGGGTCAC -3'

Sequencing Primer
(F):5'- TCAAGTGGATTGAGGATGGAATCCC -3'
(R):5'- TCTGCTGAGGTGCAAACC -3'
Posted On2015-06-24