Incidental Mutation 'R4358:Slc38a11'
ID324643
Institutional Source Beutler Lab
Gene Symbol Slc38a11
Ensembl Gene ENSMUSG00000061171
Gene Namesolute carrier family 38, member 11
Synonyms9330158F14Rik
MMRRC Submission 041110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4358 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65316430-65364034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65358116 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 103 (K103R)
Ref Sequence ENSEMBL: ENSMUSP00000121205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112420] [ENSMUST00000152324]
Predicted Effect probably benign
Transcript: ENSMUST00000112420
AA Change: K103R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108039
Gene: ENSMUSG00000061171
AA Change: K103R

DomainStartEndE-ValueType
Pfam:Aa_trans 32 420 1.6e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124918
AA Change: K63R
SMART Domains Protein: ENSMUSP00000120185
Gene: ENSMUSG00000061171
AA Change: K63R

DomainStartEndE-ValueType
Pfam:Aa_trans 26 381 8.5e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127623
AA Change: K49R
SMART Domains Protein: ENSMUSP00000120737
Gene: ENSMUSG00000061171
AA Change: K49R

DomainStartEndE-ValueType
Pfam:Aa_trans 1 345 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145583
Predicted Effect probably benign
Transcript: ENSMUST00000152324
AA Change: K103R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121205
Gene: ENSMUSG00000061171
AA Change: K103R

DomainStartEndE-ValueType
Pfam:Aa_trans 32 367 4.8e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155422
Predicted Effect unknown
Transcript: ENSMUST00000155962
AA Change: K100R
SMART Domains Protein: ENSMUSP00000118837
Gene: ENSMUSG00000061171
AA Change: K100R

DomainStartEndE-ValueType
Pfam:Aa_trans 30 204 1.1e-30 PFAM
Pfam:Trp_Tyr_perm 31 201 3.8e-8 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Birc6 T A 17: 74,619,668 probably null Het
Chil3 G A 3: 106,160,499 Q117* probably null Het
Daglb T C 5: 143,473,134 probably benign Het
Dnah11 G A 12: 118,125,843 R1163* probably null Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Golga4 A G 9: 118,551,878 E507G probably benign Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
L3hypdh A T 12: 72,077,424 D247E probably damaging Het
Lama2 A T 10: 26,984,493 N2999K probably damaging Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mcm9 A C 10: 53,537,653 C444G probably benign Het
Mecom G A 3: 29,979,785 Q246* probably null Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Olfr13 T A 6: 43,174,226 M80K probably damaging Het
Olfr943 G A 9: 39,184,568 C127Y probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pms2 T A 5: 143,925,926 F617Y probably damaging Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd13 G T 7: 140,889,505 probably benign Het
Pygl G A 12: 70,195,690 S573L probably damaging Het
Rapgef3 A G 15: 97,748,648 V794A probably benign Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Rb1cc1 A G 1: 6,245,637 D555G probably damaging Het
Rptor G T 11: 119,671,345 E111D probably damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scn4a G A 11: 106,348,857 probably null Het
Scn8a G A 15: 100,940,133 A94T probably benign Het
Slc26a6 T A 9: 108,861,783 C636S probably benign Het
Sned1 T C 1: 93,274,659 L675P probably benign Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Tmem132d G A 5: 127,984,341 T399M possibly damaging Het
Zfp939 A G 7: 39,473,720 noncoding transcript Het
Zfp951 T C 5: 104,814,675 K342E probably damaging Het
Other mutations in Slc38a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Slc38a11 APN 2 65353782 missense probably damaging 1.00
IGL01467:Slc38a11 APN 2 65316856 missense probably benign 0.00
IGL02585:Slc38a11 APN 2 65335791 missense probably benign 0.01
IGL03001:Slc38a11 APN 2 65353815 missense probably damaging 0.97
R0458:Slc38a11 UTSW 2 65363469 critical splice acceptor site probably null
R0514:Slc38a11 UTSW 2 65316865 missense probably benign 0.08
R0815:Slc38a11 UTSW 2 65353780 missense possibly damaging 0.79
R1695:Slc38a11 UTSW 2 65316971 missense probably damaging 1.00
R1751:Slc38a11 UTSW 2 65350108 missense probably benign 0.44
R1760:Slc38a11 UTSW 2 65355319 splice site probably null
R1854:Slc38a11 UTSW 2 65363516 intron probably null
R1961:Slc38a11 UTSW 2 65330339 missense possibly damaging 0.65
R1991:Slc38a11 UTSW 2 65330339 missense probably benign 0.22
R2046:Slc38a11 UTSW 2 65358185 missense probably damaging 0.99
R2078:Slc38a11 UTSW 2 65330384 missense possibly damaging 0.81
R2103:Slc38a11 UTSW 2 65330339 missense probably benign 0.22
R3154:Slc38a11 UTSW 2 65330335 missense probably damaging 0.98
R5635:Slc38a11 UTSW 2 65361403 critical splice acceptor site probably null
R5729:Slc38a11 UTSW 2 65317021 missense probably benign 0.00
R6059:Slc38a11 UTSW 2 65334745 missense probably damaging 1.00
R6755:Slc38a11 UTSW 2 65363891 missense probably benign
R7339:Slc38a11 UTSW 2 65326570 missense probably benign
R7360:Slc38a11 UTSW 2 65353795 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TATGTGGATGTACGCATGCC -3'
(R):5'- AGACAATTCAGTTGAAGCATGC -3'

Sequencing Primer
(F):5'- ATGTACGCATGCCTCTGTG -3'
(R):5'- TTCAGTTGAAGCATGCAAACGC -3'
Posted On2015-06-24