Incidental Mutation 'R4358:Chil3'
ID324646
Institutional Source Beutler Lab
Gene Symbol Chil3
Ensembl Gene ENSMUSG00000040809
Gene Namechitinase-like 3
SynonymsYm1, Chi3l3
MMRRC Submission 041110-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R4358 (G1)
Quality Score138
Status Validated
Chromosome3
Chromosomal Location106147554-106167564 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 106160499 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 117 (Q117*)
Ref Sequence ENSEMBL: ENSMUSP00000053923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063062]
PDB Structure
THE CRYSTAL STRUCTURE OF NOVEL MAMMALIAN LECTIN YM1 SUGGESTS A SACCHARIDE BINDING SITE [X-RAY DIFFRACTION]
The Crystal Structure of Ym1 at 1.31 A Resolution [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000063062
AA Change: Q117*
SMART Domains Protein: ENSMUSP00000053923
Gene: ENSMUSG00000040809
AA Change: Q117*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 5.17e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129563
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is thought to function as a lectin and may be involved in inflammation and allergy. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Birc6 T A 17: 74,619,668 probably null Het
Daglb T C 5: 143,473,134 probably benign Het
Dnah11 G A 12: 118,125,843 R1163* probably null Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Golga4 A G 9: 118,551,878 E507G probably benign Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
L3hypdh A T 12: 72,077,424 D247E probably damaging Het
Lama2 A T 10: 26,984,493 N2999K probably damaging Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mcm9 A C 10: 53,537,653 C444G probably benign Het
Mecom G A 3: 29,979,785 Q246* probably null Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Olfr13 T A 6: 43,174,226 M80K probably damaging Het
Olfr943 G A 9: 39,184,568 C127Y probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pms2 T A 5: 143,925,926 F617Y probably damaging Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd13 G T 7: 140,889,505 probably benign Het
Pygl G A 12: 70,195,690 S573L probably damaging Het
Rapgef3 A G 15: 97,748,648 V794A probably benign Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Rb1cc1 A G 1: 6,245,637 D555G probably damaging Het
Rptor G T 11: 119,671,345 E111D probably damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scn4a G A 11: 106,348,857 probably null Het
Scn8a G A 15: 100,940,133 A94T probably benign Het
Slc26a6 T A 9: 108,861,783 C636S probably benign Het
Slc38a11 T C 2: 65,358,116 K103R probably benign Het
Sned1 T C 1: 93,274,659 L675P probably benign Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Tmem132d G A 5: 127,984,341 T399M possibly damaging Het
Zfp939 A G 7: 39,473,720 noncoding transcript Het
Zfp951 T C 5: 104,814,675 K342E probably damaging Het
Other mutations in Chil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chil3 APN 3 106148701 missense probably damaging 1.00
IGL01552:Chil3 APN 3 106148848 missense probably damaging 0.98
IGL02538:Chil3 APN 3 106164129 missense probably damaging 1.00
PIT4382001:Chil3 UTSW 3 106148659 missense probably damaging 1.00
R0145:Chil3 UTSW 3 106160478 missense probably damaging 1.00
R0269:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0310:Chil3 UTSW 3 106160523 missense possibly damaging 0.75
R0453:Chil3 UTSW 3 106148905 missense probably benign 0.26
R0541:Chil3 UTSW 3 106161232 critical splice acceptor site probably null
R0617:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0831:Chil3 UTSW 3 106149747 missense probably benign 0.19
R1699:Chil3 UTSW 3 106160366 critical splice donor site probably null
R1851:Chil3 UTSW 3 106148801 critical splice donor site probably null
R1852:Chil3 UTSW 3 106148801 critical splice donor site probably null
R2105:Chil3 UTSW 3 106160478 missense possibly damaging 0.73
R2202:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2204:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2205:Chil3 UTSW 3 106164246 missense probably benign 0.11
R4492:Chil3 UTSW 3 106155701 missense probably damaging 1.00
R4543:Chil3 UTSW 3 106160370 missense probably benign
R4554:Chil3 UTSW 3 106160370 missense probably benign
R4930:Chil3 UTSW 3 106164208 missense possibly damaging 0.67
R5011:Chil3 UTSW 3 106150161 missense possibly damaging 0.46
R5083:Chil3 UTSW 3 106164089 critical splice donor site probably null
R5231:Chil3 UTSW 3 106155729 missense probably damaging 0.96
R5423:Chil3 UTSW 3 106148662 missense probably damaging 1.00
R6804:Chil3 UTSW 3 106164179 nonsense probably null
R6859:Chil3 UTSW 3 106160414 missense probably benign 0.14
R7218:Chil3 UTSW 3 106160537 splice site probably null
R7391:Chil3 UTSW 3 106164180 missense probably damaging 1.00
R7426:Chil3 UTSW 3 106155706 missense probably benign 0.05
R7582:Chil3 UTSW 3 106164256 missense probably damaging 1.00
R7620:Chil3 UTSW 3 106160435 missense probably damaging 1.00
R7647:Chil3 UTSW 3 106148806 missense possibly damaging 0.73
R7749:Chil3 UTSW 3 106148845 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGAGAGATTTAAACCTTTTAGCACC -3'
(R):5'- ATGTTCTCCAGACCAGAGGG -3'

Sequencing Primer
(F):5'- GCACCAAAGAATTTTTCCAATTGAC -3'
(R):5'- AACTATGGCCCCTAATTAGGAAG -3'
Posted On2015-06-24