Mutagenetix > Incidental Mutation

Incidental Mutation 'R4358:Alpk1'

324647

Institutional Source

Beutler Lab

Gene Symbol

Alpk1

Ensembl Gene

ENSMUSG00000028028

Gene Name

alpha-kinase 1

Synonyms

8430410J10Rik

MMRRC Submission

041110-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127670310-127780527 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127729373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 7 (V7M)

Ref Sequence

ENSEMBL: ENSMUSP00000143223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000029662
AA Change: V7M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: V7M

Domain	Start	End	E-Value	Type
low complexity region	85	97	N/A	INTRINSIC
low complexity region	618	628	N/A	INTRINSIC
low complexity region	700	714	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
low complexity region	924	947	N/A	INTRINSIC
Alpha_kinase	1008	1215	1.03e-81	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161239

Predicted Effect

probably damaging
Transcript: ENSMUST00000198955
AA Change: V7M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: V7M

Domain	Start	End	E-Value	Type
low complexity region	85	97	N/A	INTRINSIC
low complexity region	618	628	N/A	INTRINSIC
low complexity region	700	714	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
low complexity region	924	947	N/A	INTRINSIC
Alpha_kinase	1008	1215	1.03e-81	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Birc6	T	A	17: 74,619,668		probably null	Het
Chil3	G	A	3: 106,160,499	Q117*	probably null	Het
Daglb	T	C	5: 143,473,134		probably benign	Het
Dnah11	G	A	12: 118,125,843	R1163*	probably null	Het
Ftsj3	G	A	11: 106,253,676	A134V	probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Golga4	A	G	9: 118,551,878	E507G	probably benign	Het
Ids	C	A	X: 70,346,344	G506C	probably damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
L3hypdh	A	T	12: 72,077,424	D247E	probably damaging	Het
Lama2	A	T	10: 26,984,493	N2999K	probably damaging	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Mcm9	A	C	10: 53,537,653	C444G	probably benign	Het
Mecom	G	A	3: 29,979,785	Q246*	probably null	Het
Mib1	A	G	18: 10,751,844	N242S	probably benign	Het
Olfr13	T	A	6: 43,174,226	M80K	probably damaging	Het
Olfr943	G	A	9: 39,184,568	C127Y	probably damaging	Het
P3h4	A	G	11: 100,413,626	F263S	probably damaging	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pms2	T	A	5: 143,925,926	F617Y	probably damaging	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Psmd13	G	T	7: 140,889,505		probably benign	Het
Pygl	G	A	12: 70,195,690	S573L	probably damaging	Het
Rapgef3	A	G	15: 97,748,648	V794A	probably benign	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Rb1cc1	A	G	1: 6,245,637	D555G	probably damaging	Het
Rptor	G	T	11: 119,671,345	E111D	probably damaging	Het
Sall4	T	C	2: 168,755,480	E480G	probably benign	Het
Scn4a	G	A	11: 106,348,857		probably null	Het
Scn8a	G	A	15: 100,940,133	A94T	probably benign	Het
Slc26a6	T	A	9: 108,861,783	C636S	probably benign	Het
Slc38a11	T	C	2: 65,358,116	K103R	probably benign	Het
Sned1	T	C	1: 93,274,659	L675P	probably benign	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Tmem132d	G	A	5: 127,984,341	T399M	possibly damaging	Het
Zfp939	A	G	7: 39,473,720		noncoding transcript	Het
Zfp951	T	C	5: 104,814,675	K342E	probably damaging	Het

Other mutations in Alpk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Alpk1	APN	3	127681043	missense	probably damaging	1.00
IGL00722:Alpk1	APN	3	127680213	missense	probably benign	0.00
IGL01066:Alpk1	APN	3	127680225	missense	probably benign	0.22
IGL01351:Alpk1	APN	3	127672362	missense	probably damaging	0.97
IGL01412:Alpk1	APN	3	127679972	missense	possibly damaging	0.60
IGL01469:Alpk1	APN	3	127677752	splice site	probably null
IGL01585:Alpk1	APN	3	127679813	missense	probably benign	0.01
IGL02308:Alpk1	APN	3	127729282	missense	probably damaging	0.99
IGL02325:Alpk1	APN	3	127679903	missense	probably benign	0.43
IGL02458:Alpk1	APN	3	127681319	critical splice donor site	probably null
IGL02553:Alpk1	APN	3	127673321	missense	probably damaging	1.00
IGL02717:Alpk1	APN	3	127681100	missense	possibly damaging	0.76
IGL02729:Alpk1	APN	3	127681072	missense	possibly damaging	0.87
IGL02832:Alpk1	APN	3	127679943	missense	possibly damaging	0.63
IGL02892:Alpk1	APN	3	127680122	missense	possibly damaging	0.92
IGL03178:Alpk1	APN	3	127680221	nonsense	probably null
R0427:Alpk1	UTSW	3	127671071	missense	probably damaging	1.00
R0981:Alpk1	UTSW	3	127679402	missense	possibly damaging	0.62
R1174:Alpk1	UTSW	3	127680810	missense	probably damaging	0.99
R1793:Alpk1	UTSW	3	127677798	missense	probably damaging	1.00
R1859:Alpk1	UTSW	3	127681100	missense	possibly damaging	0.76
R2173:Alpk1	UTSW	3	127683590	missense	probably damaging	1.00
R2235:Alpk1	UTSW	3	127680920	missense	probably benign	0.01
R2373:Alpk1	UTSW	3	127679808	missense	probably benign	0.00
R3803:Alpk1	UTSW	3	127679837	missense	possibly damaging	0.93
R3927:Alpk1	UTSW	3	127677716	missense	probably damaging	1.00
R4356:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4357:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4379:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4381:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4470:Alpk1	UTSW	3	127679526	missense	probably damaging	1.00
R4471:Alpk1	UTSW	3	127679526	missense	probably damaging	1.00
R4473:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4474:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4476:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4512:Alpk1	UTSW	3	127684471	intron	probably benign
R4594:Alpk1	UTSW	3	127683554	missense	probably damaging	1.00
R4678:Alpk1	UTSW	3	127679858	missense	probably damaging	0.99
R4707:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4784:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4785:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4820:Alpk1	UTSW	3	127671059	missense	probably benign	0.06
R4887:Alpk1	UTSW	3	127673475	missense	probably damaging	1.00
R5088:Alpk1	UTSW	3	127685320	splice site	probably benign
R5169:Alpk1	UTSW	3	127671101	missense	probably damaging	1.00
R5280:Alpk1	UTSW	3	127681164	missense	probably benign	0.00
R5351:Alpk1	UTSW	3	127729292	missense	probably damaging	0.96
R5478:Alpk1	UTSW	3	127677719	missense	probably damaging	1.00
R5627:Alpk1	UTSW	3	127680647	missense	probably damaging	0.99
R5781:Alpk1	UTSW	3	127680035	missense	possibly damaging	0.92
R5842:Alpk1	UTSW	3	127680969	missense	probably damaging	1.00
R5847:Alpk1	UTSW	3	127680074	missense	probably benign	0.06
R5940:Alpk1	UTSW	3	127670946	missense	probably benign
R6187:Alpk1	UTSW	3	127673342	missense	probably damaging	1.00
R6306:Alpk1	UTSW	3	127686316	missense	probably damaging	1.00
R6414:Alpk1	UTSW	3	127680209	missense	probably benign
R6701:Alpk1	UTSW	3	127729336	missense	probably damaging	1.00
R6735:Alpk1	UTSW	3	127724449	missense	probably damaging	1.00
R6850:Alpk1	UTSW	3	127729363	missense	possibly damaging	0.87
R7173:Alpk1	UTSW	3	127684375	nonsense	probably null
R7258:Alpk1	UTSW	3	127724466	missense	probably damaging	1.00
R7412:Alpk1	UTSW	3	127672494	missense	probably damaging	1.00
R7412:Alpk1	UTSW	3	127695733	missense	probably damaging	1.00
R7498:Alpk1	UTSW	3	127679778	missense	probably benign	0.22
R7635:Alpk1	UTSW	3	127695661	missense	probably benign	0.01
R7660:Alpk1	UTSW	3	127680967	missense	probably damaging	1.00
R7682:Alpk1	UTSW	3	127672546	missense	possibly damaging	0.94
R7732:Alpk1	UTSW	3	127684392	missense
R7827:Alpk1	UTSW	3	127680051	missense	probably benign	0.00
R8029:Alpk1	UTSW	3	127729285	missense	possibly damaging	0.95
R8383:Alpk1	UTSW	3	127724436	missense	probably benign	0.41
R8478:Alpk1	UTSW	3	127729312	missense	probably damaging	1.00
R8765:Alpk1	UTSW	3	127672469	missense	probably damaging	1.00
R8816:Alpk1	UTSW	3	127684375	nonsense	probably null
R8907:Alpk1	UTSW	3	127680993	nonsense	probably null
R8972:Alpk1	UTSW	3	127679583	missense	probably damaging	1.00
R8974:Alpk1	UTSW	3	127679931	missense	probably benign	0.03
R9039:Alpk1	UTSW	3	127679543	missense	probably damaging	1.00
R9202:Alpk1	UTSW	3	127686289	missense
R9394:Alpk1	UTSW	3	127672538	missense	probably damaging	1.00
R9421:Alpk1	UTSW	3	127673420	missense	probably damaging	1.00
R9436:Alpk1	UTSW	3	127685275	missense
R9785:Alpk1	UTSW	3	127679945	missense	probably benign	0.22
Z1176:Alpk1	UTSW	3	127673438	missense	probably damaging	1.00
Z1177:Alpk1	UTSW	3	127685307	missense

Predicted Primers

PCR Primer
(F):5'- TGGTCATCTGCCAGGAGAAG -3'
(R):5'- GCTTGAGACTCGCAGATAATTGATG -3'

Sequencing Primer
(F):5'- GGAGAATATGTCGCTCAGGC -3'
(R):5'- CTCGCAGATAATTGATGATGCTTTAG -3'

Posted On

2015-06-24