Mutagenetix > Incidental Mutation

Incidental Mutation 'R4358:Kif24'

324648

Institutional Source

Beutler Lab

Gene Symbol

Kif24

Ensembl Gene

ENSMUSG00000028438

Gene Name

kinesin family member 24

Synonyms

4933425J19Rik

MMRRC Submission

041110-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41390745-41464887 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 41413827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103690 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000108055]

AlphaFold

Q6NWW5

Predicted Effect

probably benign
Transcript: ENSMUST00000030148

SMART Domains

Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438

Domain	Start	End	E-Value	Type
KISc	216	413	2.51e-29	SMART
low complexity region	481	499	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	626	644	N/A	INTRINSIC
low complexity region	678	695	N/A	INTRINSIC
low complexity region	1119	1130	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108055

SMART Domains

Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438

Domain	Start	End	E-Value	Type
Blast:KISc	82	205	1e-47	BLAST
KISc	216	547	3.09e-134	SMART
low complexity region	615	633	N/A	INTRINSIC
low complexity region	697	708	N/A	INTRINSIC
low complexity region	760	778	N/A	INTRINSIC
low complexity region	812	829	N/A	INTRINSIC
low complexity region	1253	1264	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141951

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154175

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
Birc6	T	A	17: 74,619,668		probably null	Het
Chil3	G	A	3: 106,160,499	Q117*	probably null	Het
Daglb	T	C	5: 143,473,134		probably benign	Het
Dnah11	G	A	12: 118,125,843	R1163*	probably null	Het
Ftsj3	G	A	11: 106,253,676	A134V	probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Golga4	A	G	9: 118,551,878	E507G	probably benign	Het
Ids	C	A	X: 70,346,344	G506C	probably damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
L3hypdh	A	T	12: 72,077,424	D247E	probably damaging	Het
Lama2	A	T	10: 26,984,493	N2999K	probably damaging	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Mcm9	A	C	10: 53,537,653	C444G	probably benign	Het
Mecom	G	A	3: 29,979,785	Q246*	probably null	Het
Mib1	A	G	18: 10,751,844	N242S	probably benign	Het
Olfr13	T	A	6: 43,174,226	M80K	probably damaging	Het
Olfr943	G	A	9: 39,184,568	C127Y	probably damaging	Het
P3h4	A	G	11: 100,413,626	F263S	probably damaging	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pms2	T	A	5: 143,925,926	F617Y	probably damaging	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Psmd13	G	T	7: 140,889,505		probably benign	Het
Pygl	G	A	12: 70,195,690	S573L	probably damaging	Het
Rapgef3	A	G	15: 97,748,648	V794A	probably benign	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Rb1cc1	A	G	1: 6,245,637	D555G	probably damaging	Het
Rptor	G	T	11: 119,671,345	E111D	probably damaging	Het
Sall4	T	C	2: 168,755,480	E480G	probably benign	Het
Scn4a	G	A	11: 106,348,857		probably null	Het
Scn8a	G	A	15: 100,940,133	A94T	probably benign	Het
Slc26a6	T	A	9: 108,861,783	C636S	probably benign	Het
Slc38a11	T	C	2: 65,358,116	K103R	probably benign	Het
Sned1	T	C	1: 93,274,659	L675P	probably benign	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Tmem132d	G	A	5: 127,984,341	T399M	possibly damaging	Het
Zfp939	A	G	7: 39,473,720		noncoding transcript	Het
Zfp951	T	C	5: 104,814,675	K342E	probably damaging	Het

Other mutations in Kif24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Kif24	APN	4	41413826	splice site	probably null
IGL00787:Kif24	APN	4	41397583	missense	probably damaging	1.00
IGL01065:Kif24	APN	4	41423639	unclassified	probably benign
IGL01716:Kif24	APN	4	41393454	missense	probably benign	0.40
IGL01796:Kif24	APN	4	41392978	unclassified	probably benign
IGL02307:Kif24	APN	4	41395274	missense	probably benign	0.02
IGL03061:Kif24	APN	4	41394323	missense	possibly damaging	0.86
IGL03080:Kif24	APN	4	41394417	missense	probably benign	0.12
IGL03100:Kif24	APN	4	41394446	missense	possibly damaging	0.59
R0226:Kif24	UTSW	4	41414939	nonsense	probably null
R0345:Kif24	UTSW	4	41428413	missense	probably benign	0.01
R0365:Kif24	UTSW	4	41428731	missense	probably benign	0.06
R0366:Kif24	UTSW	4	41428717	missense	possibly damaging	0.77
R0579:Kif24	UTSW	4	41393706	missense	probably damaging	0.97
R0682:Kif24	UTSW	4	41428620	missense	probably benign	0.01
R1611:Kif24	UTSW	4	41423552	missense	probably benign	0.02
R1634:Kif24	UTSW	4	41393529	missense	probably benign	0.02
R1772:Kif24	UTSW	4	41409787	missense	probably damaging	1.00
R1997:Kif24	UTSW	4	41392904	missense	possibly damaging	0.92
R3833:Kif24	UTSW	4	41395064	missense	probably damaging	1.00
R3849:Kif24	UTSW	4	41404734	missense	probably damaging	1.00
R4356:Kif24	UTSW	4	41413827	critical splice donor site	probably null
R4357:Kif24	UTSW	4	41413827	critical splice donor site	probably null
R4359:Kif24	UTSW	4	41413827	critical splice donor site	probably null
R4406:Kif24	UTSW	4	41393954	missense	probably damaging	1.00
R4580:Kif24	UTSW	4	41395287	missense	probably damaging	1.00
R4756:Kif24	UTSW	4	41397545	critical splice donor site	probably null
R4921:Kif24	UTSW	4	41394329	missense	probably damaging	0.99
R4935:Kif24	UTSW	4	41394939	missense	probably damaging	0.99
R5288:Kif24	UTSW	4	41395373	missense	probably benign	0.09
R5398:Kif24	UTSW	4	41394401	missense	possibly damaging	0.50
R5885:Kif24	UTSW	4	41423463	missense	probably damaging	1.00
R5901:Kif24	UTSW	4	41428604	missense	probably damaging	1.00
R5919:Kif24	UTSW	4	41394477	missense	possibly damaging	0.62
R5945:Kif24	UTSW	4	41428670	nonsense	probably null
R6278:Kif24	UTSW	4	41423498	missense	probably damaging	1.00
R6291:Kif24	UTSW	4	41413959	missense	probably damaging	1.00
R6891:Kif24	UTSW	4	41394168	missense	probably benign	0.33
R7178:Kif24	UTSW	4	41395085	missense	probably benign	0.00
R7437:Kif24	UTSW	4	41404687	missense	possibly damaging	0.70
R7453:Kif24	UTSW	4	41394673	missense	possibly damaging	0.91
R7543:Kif24	UTSW	4	41413993	nonsense	probably null
R7548:Kif24	UTSW	4	41423601	missense	possibly damaging	0.57
R8167:Kif24	UTSW	4	41392957	missense	possibly damaging	0.87
R8305:Kif24	UTSW	4	41428825	missense	probably damaging	1.00
R8407:Kif24	UTSW	4	41394488	missense	probably benign	0.05
R8722:Kif24	UTSW	4	41394233	missense	probably benign
R8916:Kif24	UTSW	4	41394963	missense	probably benign	0.23
R9093:Kif24	UTSW	4	41428691	missense	probably benign
R9172:Kif24	UTSW	4	41400442	missense	probably benign	0.44
R9468:Kif24	UTSW	4	41404794	missense	probably damaging	1.00
R9687:Kif24	UTSW	4	41428546	missense	probably damaging	0.99
Z1088:Kif24	UTSW	4	41395091	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTTAGTAGATGGCTAAGGAACAG -3'
(R):5'- ACCTATACCATGATAGGAACTCATC -3'

Sequencing Primer
(F):5'- ATTCCATCACTTGGGAAGCTGAGTC -3'
(R):5'- CAAAACCCAGGATTGTATGCTCTGG -3'

Posted On

2015-06-24