Mutagenetix > Incidental Mutation

Incidental Mutation 'R4358:Igsf9b'

324660

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

041110-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.466) question?

Stock #

R4358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27309478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 47 (V47I)

Ref Sequence

ENSEMBL: ENSMUSP00000117017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

AlphaFold

E9PZ19

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115247
AA Change: V47I

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: V47I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133213
AA Change: V47I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: V47I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214357
AA Change: V47I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
Birc6	T	A	17: 74,619,668		probably null	Het
Chil3	G	A	3: 106,160,499	Q117*	probably null	Het
Daglb	T	C	5: 143,473,134		probably benign	Het
Dnah11	G	A	12: 118,125,843	R1163*	probably null	Het
Ftsj3	G	A	11: 106,253,676	A134V	probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Golga4	A	G	9: 118,551,878	E507G	probably benign	Het
Ids	C	A	X: 70,346,344	G506C	probably damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Kif24	A	G	4: 41,413,827		probably null	Het
L3hypdh	A	T	12: 72,077,424	D247E	probably damaging	Het
Lama2	A	T	10: 26,984,493	N2999K	probably damaging	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Mcm9	A	C	10: 53,537,653	C444G	probably benign	Het
Mecom	G	A	3: 29,979,785	Q246*	probably null	Het
Mib1	A	G	18: 10,751,844	N242S	probably benign	Het
Olfr13	T	A	6: 43,174,226	M80K	probably damaging	Het
Olfr943	G	A	9: 39,184,568	C127Y	probably damaging	Het
P3h4	A	G	11: 100,413,626	F263S	probably damaging	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pms2	T	A	5: 143,925,926	F617Y	probably damaging	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Psmd13	G	T	7: 140,889,505		probably benign	Het
Pygl	G	A	12: 70,195,690	S573L	probably damaging	Het
Rapgef3	A	G	15: 97,748,648	V794A	probably benign	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Rb1cc1	A	G	1: 6,245,637	D555G	probably damaging	Het
Rptor	G	T	11: 119,671,345	E111D	probably damaging	Het
Sall4	T	C	2: 168,755,480	E480G	probably benign	Het
Scn4a	G	A	11: 106,348,857		probably null	Het
Scn8a	G	A	15: 100,940,133	A94T	probably benign	Het
Slc26a6	T	A	9: 108,861,783	C636S	probably benign	Het
Slc38a11	T	C	2: 65,358,116	K103R	probably benign	Het
Sned1	T	C	1: 93,274,659	L675P	probably benign	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Tmem132d	G	A	5: 127,984,341	T399M	possibly damaging	Het
Zfp939	A	G	7: 39,473,720		noncoding transcript	Het
Zfp951	T	C	5: 104,814,675	K342E	probably damaging	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
G1Funyon:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
R8301:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
R8546:Igsf9b	UTSW	9	27333130	missense	possibly damaging	0.54
R8553:Igsf9b	UTSW	9	27333443	missense	probably damaging	0.96
R9438:Igsf9b	UTSW	9	27332543	missense	probably benign	0.03
R9585:Igsf9b	UTSW	9	27322236	missense	probably damaging	1.00
R9720:Igsf9b	UTSW	9	27309514	missense	probably damaging	0.99
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATAAGAGATGGGTGTCCTGGG -3'
(R):5'- AACACAGTCAAAACCTGGGG -3'

Sequencing Primer
(F):5'- GTCCTGGGTGTACTAGGGAC -3'
(R):5'- TACTCAGGGTCCACATGT -3'

Posted On

2015-06-24