Mutagenetix > Incidental Mutation

Incidental Mutation 'R4358:Mcm9'

324665

Institutional Source

Beutler Lab

Gene Symbol

Mcm9

Ensembl Gene

ENSMUSG00000058298

Gene Name

minichromosome maintenance 9 homologous recombination repair factor

Synonyms

Mcmdc1, 9030408O17Rik

MMRRC Submission

041110-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53536315-53630439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53537653 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 444 (C444G)

Ref Sequence

ENSEMBL: ENSMUSP00000151956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075540] [ENSMUST00000219547] [ENSMUST00000220007]

AlphaFold

Q2KHI9

Predicted Effect

probably benign
Transcript: ENSMUST00000075540
AA Change: C1182G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298
AA Change: C1182G

Domain	Start	End	E-Value	Type
low complexity region	22	44	N/A	INTRINSIC
low complexity region	62	79	N/A	INTRINSIC
low complexity region	81	111	N/A	INTRINSIC
MCM	268	761	9.44e-116	SMART
AAA	500	649	2.43e-6	SMART
coiled coil region	789	817	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1028	N/A	INTRINSIC
low complexity region	1045	1056	N/A	INTRINSIC
low complexity region	1199	1216	N/A	INTRINSIC
low complexity region	1219	1232	N/A	INTRINSIC
low complexity region	1246	1255	N/A	INTRINSIC
low complexity region	1262	1276	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219547
AA Change: C444G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000220007
AA Change: C444G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for gene trap alleles display germ cell loss with reduced fertility or infertility and increased tumor incidence, particulary of hepatocellular carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
Birc6	T	A	17: 74,619,668		probably null	Het
Chil3	G	A	3: 106,160,499	Q117*	probably null	Het
Daglb	T	C	5: 143,473,134		probably benign	Het
Dnah11	G	A	12: 118,125,843	R1163*	probably null	Het
Ftsj3	G	A	11: 106,253,676	A134V	probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Golga4	A	G	9: 118,551,878	E507G	probably benign	Het
Ids	C	A	X: 70,346,344	G506C	probably damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
L3hypdh	A	T	12: 72,077,424	D247E	probably damaging	Het
Lama2	A	T	10: 26,984,493	N2999K	probably damaging	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Mecom	G	A	3: 29,979,785	Q246*	probably null	Het
Mib1	A	G	18: 10,751,844	N242S	probably benign	Het
Olfr13	T	A	6: 43,174,226	M80K	probably damaging	Het
Olfr943	G	A	9: 39,184,568	C127Y	probably damaging	Het
P3h4	A	G	11: 100,413,626	F263S	probably damaging	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pms2	T	A	5: 143,925,926	F617Y	probably damaging	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Psmd13	G	T	7: 140,889,505		probably benign	Het
Pygl	G	A	12: 70,195,690	S573L	probably damaging	Het
Rapgef3	A	G	15: 97,748,648	V794A	probably benign	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Rb1cc1	A	G	1: 6,245,637	D555G	probably damaging	Het
Rptor	G	T	11: 119,671,345	E111D	probably damaging	Het
Sall4	T	C	2: 168,755,480	E480G	probably benign	Het
Scn4a	G	A	11: 106,348,857		probably null	Het
Scn8a	G	A	15: 100,940,133	A94T	probably benign	Het
Slc26a6	T	A	9: 108,861,783	C636S	probably benign	Het
Slc38a11	T	C	2: 65,358,116	K103R	probably benign	Het
Sned1	T	C	1: 93,274,659	L675P	probably benign	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Tmem132d	G	A	5: 127,984,341	T399M	possibly damaging	Het
Zfp939	A	G	7: 39,473,720		noncoding transcript	Het
Zfp951	T	C	5: 104,814,675	K342E	probably damaging	Het

Other mutations in Mcm9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Mcm9	APN	10	53622973	missense	probably damaging	0.97
IGL00904:Mcm9	APN	10	53622921	missense	possibly damaging	0.89
IGL00943:Mcm9	APN	10	53548589	missense	probably damaging	1.00
IGL01019:Mcm9	APN	10	53629945	missense	probably damaging	1.00
IGL02452:Mcm9	APN	10	53541557	missense	probably damaging	1.00
IGL02481:Mcm9	APN	10	53625937	missense	probably damaging	1.00
IGL02982:Mcm9	APN	10	53625826	missense	probably damaging	0.99
IGL03300:Mcm9	APN	10	53611427	missense	probably damaging	1.00
R0021:Mcm9	UTSW	10	53537901	missense	possibly damaging	0.94
R0117:Mcm9	UTSW	10	53537736	missense	possibly damaging	0.49
R0137:Mcm9	UTSW	10	53563430	missense	possibly damaging	0.95
R0420:Mcm9	UTSW	10	53548527	missense	probably benign	0.10
R0499:Mcm9	UTSW	10	53538154	missense	probably benign	0.01
R0543:Mcm9	UTSW	10	53541598	missense	probably damaging	0.97
R0947:Mcm9	UTSW	10	53537501	small deletion	probably benign
R0975:Mcm9	UTSW	10	53538646	nonsense	probably null
R1573:Mcm9	UTSW	10	53548656	missense	probably damaging	0.97
R1726:Mcm9	UTSW	10	53537881	missense	possibly damaging	0.67
R1839:Mcm9	UTSW	10	53541553	missense	probably damaging	0.99
R2050:Mcm9	UTSW	10	53612825	critical splice donor site	probably null
R2113:Mcm9	UTSW	10	53615847	splice site	probably null
R2172:Mcm9	UTSW	10	53548574	missense	probably damaging	1.00
R3417:Mcm9	UTSW	10	53537407	missense	possibly damaging	0.83
R3755:Mcm9	UTSW	10	53625952	missense	probably benign	0.08
R3787:Mcm9	UTSW	10	53615980	missense	possibly damaging	0.78
R3789:Mcm9	UTSW	10	53616017	missense	probably damaging	1.00
R3953:Mcm9	UTSW	10	53563344	missense	probably damaging	1.00
R4291:Mcm9	UTSW	10	53547572	missense	probably benign	0.22
R4660:Mcm9	UTSW	10	53548527	missense	probably benign	0.10
R4662:Mcm9	UTSW	10	53548527	missense	probably benign	0.10
R5082:Mcm9	UTSW	10	53538060	missense	possibly damaging	0.94
R5130:Mcm9	UTSW	10	53630399	missense	possibly damaging	0.90
R5193:Mcm9	UTSW	10	53616038	missense	probably damaging	0.99
R5238:Mcm9	UTSW	10	53629997	missense	possibly damaging	0.83
R5317:Mcm9	UTSW	10	53538234	missense	probably damaging	1.00
R5395:Mcm9	UTSW	10	53538692	missense	possibly damaging	0.93
R5524:Mcm9	UTSW	10	53548690	nonsense	probably null
R5593:Mcm9	UTSW	10	53538297	missense	probably damaging	0.99
R5748:Mcm9	UTSW	10	53625729	missense	probably damaging	1.00
R6025:Mcm9	UTSW	10	53615977	missense	possibly damaging	0.93
R6299:Mcm9	UTSW	10	53537681	missense	probably damaging	1.00
R6344:Mcm9	UTSW	10	53537937	missense	probably benign	0.03
R6502:Mcm9	UTSW	10	53612839	missense	probably damaging	1.00
R6621:Mcm9	UTSW	10	53563313	missense	probably damaging	1.00
R6883:Mcm9	UTSW	10	53616014	missense	probably damaging	1.00
R6932:Mcm9	UTSW	10	53620203	missense	probably benign	0.06
R6963:Mcm9	UTSW	10	53548617	missense	probably damaging	1.00
R7094:Mcm9	UTSW	10	53620157	missense	probably damaging	1.00
R7114:Mcm9	UTSW	10	53538573	missense	possibly damaging	0.55
R7200:Mcm9	UTSW	10	53615923	missense
R7593:Mcm9	UTSW	10	53629992	missense	probably benign	0.04
R7671:Mcm9	UTSW	10	53537569	missense	probably benign	0.01
R7697:Mcm9	UTSW	10	53615894	missense
R7997:Mcm9	UTSW	10	53597406	start gained	probably benign
R8136:Mcm9	UTSW	10	53611343	makesense	probably null
R8137:Mcm9	UTSW	10	53622980	missense
R8494:Mcm9	UTSW	10	53625760	missense	possibly damaging	0.48
R8526:Mcm9	UTSW	10	53630125	unclassified	probably benign
R8558:Mcm9	UTSW	10	53615972	missense	probably benign	0.07
R8703:Mcm9	UTSW	10	53629977	missense	probably damaging	0.96
R8836:Mcm9	UTSW	10	53626034	missense
R8994:Mcm9	UTSW	10	53548524	missense	probably benign	0.31
R9150:Mcm9	UTSW	10	53626014	missense
R9564:Mcm9	UTSW	10	53630008	missense	possibly damaging	0.90
Z1176:Mcm9	UTSW	10	53537507	missense	unknown
Z1176:Mcm9	UTSW	10	53629788	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGAAAGTCTGCCTTTGCTGG -3'
(R):5'- ATCCACCTCAGGAGACAGATGC -3'

Sequencing Primer
(F):5'- AGCACTGGAGCTGTGGTC -3'
(R):5'- AGATGCTCTGACCAGCTGCAC -3'

Posted On

2015-06-24