Mutagenetix > Incidental Mutation

Incidental Mutation 'R4358:Rptor'

324669

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

raptor, Rap, 4932417H02Rik

MMRRC Submission

041110-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119602905-119899576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 119671345 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 111 (E111D)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026671
AA Change: E111D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: E111D

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125583

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127899

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147772

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147781
AA Change: E111D

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583
AA Change: E111D

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Meta Mutation Damage Score

0.1418

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
Birc6	T	A	17: 74,619,668		probably null	Het
Chil3	G	A	3: 106,160,499	Q117*	probably null	Het
Daglb	T	C	5: 143,473,134		probably benign	Het
Dnah11	G	A	12: 118,125,843	R1163*	probably null	Het
Ftsj3	G	A	11: 106,253,676	A134V	probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Golga4	A	G	9: 118,551,878	E507G	probably benign	Het
Ids	C	A	X: 70,346,344	G506C	probably damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
L3hypdh	A	T	12: 72,077,424	D247E	probably damaging	Het
Lama2	A	T	10: 26,984,493	N2999K	probably damaging	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Mcm9	A	C	10: 53,537,653	C444G	probably benign	Het
Mecom	G	A	3: 29,979,785	Q246*	probably null	Het
Mib1	A	G	18: 10,751,844	N242S	probably benign	Het
Olfr13	T	A	6: 43,174,226	M80K	probably damaging	Het
Olfr943	G	A	9: 39,184,568	C127Y	probably damaging	Het
P3h4	A	G	11: 100,413,626	F263S	probably damaging	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pms2	T	A	5: 143,925,926	F617Y	probably damaging	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Psmd13	G	T	7: 140,889,505		probably benign	Het
Pygl	G	A	12: 70,195,690	S573L	probably damaging	Het
Rapgef3	A	G	15: 97,748,648	V794A	probably benign	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Rb1cc1	A	G	1: 6,245,637	D555G	probably damaging	Het
Sall4	T	C	2: 168,755,480	E480G	probably benign	Het
Scn4a	G	A	11: 106,348,857		probably null	Het
Scn8a	G	A	15: 100,940,133	A94T	probably benign	Het
Slc26a6	T	A	9: 108,861,783	C636S	probably benign	Het
Slc38a11	T	C	2: 65,358,116	K103R	probably benign	Het
Sned1	T	C	1: 93,274,659	L675P	probably benign	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Tmem132d	G	A	5: 127,984,341	T399M	possibly damaging	Het
Zfp939	A	G	7: 39,473,720		noncoding transcript	Het
Zfp951	T	C	5: 104,814,675	K342E	probably damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119799445	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119891170	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119896436	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119857453	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119657674	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119846915	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119780587	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119892612	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119725145	missense	probably damaging	1.00
Velocipede	UTSW	11	119895977	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119884967	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119872367	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119894912	splice site	probably benign
R0219:Rptor	UTSW	11	119821777	intron	probably benign
R0324:Rptor	UTSW	11	119892641	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119780553	nonsense	probably null
R0718:Rptor	UTSW	11	119872376	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119884954	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119843743	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119743891	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119780593	nonsense	probably null
R1579:Rptor	UTSW	11	119896001	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119725061	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119756320	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119725144	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119756322	nonsense	probably null
R2275:Rptor	UTSW	11	119756322	nonsense	probably null
R2408:Rptor	UTSW	11	119857451	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119865594	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119856298	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R4592:Rptor	UTSW	11	119798840	missense	probably null	1.00
R4647:Rptor	UTSW	11	119891163	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119743882	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119857391	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119821640	intron	probably benign
R5073:Rptor	UTSW	11	119896479	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119603816	missense	probably benign
R5216:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119822956	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119756249	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119897442	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119896012	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119895977	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119756345	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119846936	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119874186	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119872355	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119884979	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119743953	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119892627	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119857953	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119857937	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119811986	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119892647	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119892639	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119725032	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119603925	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119843682	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119887070	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119603939	missense	probably benign
R9224:Rptor	UTSW	11	119894287	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119811997	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119895946	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119671326	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119891114	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119887138	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119846405	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119857866	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119603972	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119756236	splice site	probably null
Z0001:Rptor	UTSW	11	119756415	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119799319	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119846752	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119851468	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119857453	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119871492	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119874151	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119896549	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- CATAGTGGGAAGTGGTTGCC -3'
(R):5'- CACTGACTGCACTGGAAAGG -3'

Sequencing Primer
(F):5'- CTGCCTTTTAGTGCGCAAG -3'
(R):5'- CTGCACTGGAAAGGCTGAC -3'

Posted On

2015-06-24