Incidental Mutation 'R4358:Rapgef3'
ID 324676
Institutional Source Beutler Lab
Gene Symbol Rapgef3
Ensembl Gene ENSMUSG00000022469
Gene Name Rap guanine nucleotide exchange factor (GEF) 3
Synonyms 2310016P22Rik, 9330170P05Rik, Epac1
MMRRC Submission 041110-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R4358 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 97744770-97767972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97748648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 794 (V794A)
Ref Sequence ENSEMBL: ENSMUSP00000118148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134885] [ENSMUST00000175894] [ENSMUST00000177352]
AlphaFold Q8VCC8
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125002
Predicted Effect probably benign
Transcript: ENSMUST00000126854
AA Change: V802A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: V802A

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 926 7.98e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128775
AA Change: V785A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: V785A

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 7e-45 BLAST
RasGEF 661 909 5.53e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129223
AA Change: V794A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: V794A

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 918 2.11e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134885
AA Change: V92A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469
AA Change: V92A

DomainStartEndE-ValueType
RasGEF 1 216 2.91e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155810
Predicted Effect probably benign
Transcript: ENSMUST00000175894
Predicted Effect probably benign
Transcript: ENSMUST00000177352
AA Change: V760A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469
AA Change: V760A

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
cNMP 203 322 2.53e-12 SMART
RasGEFN 341 472 7.04e-10 SMART
Blast:RasGEF 505 602 3e-45 BLAST
RasGEF 619 884 7.98e-95 SMART
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Birc6 T A 17: 74,619,668 probably null Het
Chil3 G A 3: 106,160,499 Q117* probably null Het
Daglb T C 5: 143,473,134 probably benign Het
Dnah11 G A 12: 118,125,843 R1163* probably null Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Golga4 A G 9: 118,551,878 E507G probably benign Het
Ids C A X: 70,346,344 G506C probably damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
L3hypdh A T 12: 72,077,424 D247E probably damaging Het
Lama2 A T 10: 26,984,493 N2999K probably damaging Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mcm9 A C 10: 53,537,653 C444G probably benign Het
Mecom G A 3: 29,979,785 Q246* probably null Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Olfr13 T A 6: 43,174,226 M80K probably damaging Het
Olfr943 G A 9: 39,184,568 C127Y probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pms2 T A 5: 143,925,926 F617Y probably damaging Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd13 G T 7: 140,889,505 probably benign Het
Pygl G A 12: 70,195,690 S573L probably damaging Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Rb1cc1 A G 1: 6,245,637 D555G probably damaging Het
Rptor G T 11: 119,671,345 E111D probably damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scn4a G A 11: 106,348,857 probably null Het
Scn8a G A 15: 100,940,133 A94T probably benign Het
Slc26a6 T A 9: 108,861,783 C636S probably benign Het
Slc38a11 T C 2: 65,358,116 K103R probably benign Het
Sned1 T C 1: 93,274,659 L675P probably benign Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Tmem132d G A 5: 127,984,341 T399M possibly damaging Het
Zfp939 A G 7: 39,473,720 noncoding transcript Het
Zfp951 T C 5: 104,814,675 K342E probably damaging Het
Other mutations in Rapgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Rapgef3 APN 15 97748223 missense probably damaging 1.00
IGL01339:Rapgef3 APN 15 97758059 missense probably damaging 1.00
IGL01670:Rapgef3 APN 15 97749662 missense probably benign 0.15
IGL01902:Rapgef3 APN 15 97750300 missense probably benign 0.32
IGL02137:Rapgef3 APN 15 97750144 missense probably benign 0.08
IGL02419:Rapgef3 APN 15 97750290 missense probably benign 0.33
IGL02427:Rapgef3 APN 15 97747136 splice site probably null
IGL02648:Rapgef3 APN 15 97758392 missense probably damaging 1.00
IGL02834:Rapgef3 APN 15 97748265 missense probably damaging 0.98
IGL03389:Rapgef3 APN 15 97749516 missense probably damaging 1.00
IGL03055:Rapgef3 UTSW 15 97749489 splice site probably benign
R0394:Rapgef3 UTSW 15 97757819 intron probably benign
R0538:Rapgef3 UTSW 15 97757817 intron probably benign
R0744:Rapgef3 UTSW 15 97761585 splice site probably benign
R1288:Rapgef3 UTSW 15 97759342 missense probably benign 0.31
R1512:Rapgef3 UTSW 15 97757501 missense probably benign 0.24
R1676:Rapgef3 UTSW 15 97761182 missense probably benign 0.35
R1745:Rapgef3 UTSW 15 97750178 missense probably benign 0.22
R1928:Rapgef3 UTSW 15 97750033 missense probably damaging 1.00
R2063:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2067:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2092:Rapgef3 UTSW 15 97760723 missense probably damaging 1.00
R4624:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4627:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4727:Rapgef3 UTSW 15 97760600 missense probably damaging 1.00
R4812:Rapgef3 UTSW 15 97753803 missense probably benign 0.21
R4928:Rapgef3 UTSW 15 97757375 missense probably damaging 1.00
R5161:Rapgef3 UTSW 15 97757725 missense probably damaging 1.00
R5442:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R5652:Rapgef3 UTSW 15 97758437 missense probably benign 0.00
R5837:Rapgef3 UTSW 15 97757342 splice site probably benign
R6056:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R6167:Rapgef3 UTSW 15 97767411 unclassified probably benign
R6694:Rapgef3 UTSW 15 97759984 missense probably benign 0.03
R7039:Rapgef3 UTSW 15 97761568 missense probably benign 0.01
R7154:Rapgef3 UTSW 15 97753877 missense probably benign
R7380:Rapgef3 UTSW 15 97766791 missense probably benign 0.00
R7655:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7656:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7754:Rapgef3 UTSW 15 97757746 missense probably damaging 1.00
R7849:Rapgef3 UTSW 15 97758390 critical splice donor site probably null
R8061:Rapgef3 UTSW 15 97761520 missense probably benign
R8117:Rapgef3 UTSW 15 97750866 missense probably benign 0.01
R8179:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
R8819:Rapgef3 UTSW 15 97748657 missense probably benign 0.39
R8820:Rapgef3 UTSW 15 97748657 missense probably benign 0.39
R8824:Rapgef3 UTSW 15 97766908 missense probably benign 0.39
R9779:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
R9781:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
R9782:Rapgef3 UTSW 15 97745598 missense probably damaging 0.99
RF024:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
X0011:Rapgef3 UTSW 15 97761473 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTATCTCCTGGGGTATCTACC -3'
(R):5'- ACTTAGAAAGCCAGGCCTCAG -3'

Sequencing Primer
(F):5'- GGTATCTACCACAGCCTCGG -3'
(R):5'- CCAGGCCTCAGTGCTGTTTG -3'
Posted On 2015-06-24