Mutagenetix > Incidental Mutation

Incidental Mutation 'R4358:Mib1'

324679

Institutional Source

Beutler Lab

Gene Symbol

Mib1

Ensembl Gene

ENSMUSG00000024294

Gene Name

mindbomb E3 ubiquitin protein ligase 1

Synonyms

Mib, mind bomb-1, skeletrophin, E430019M12Rik

MMRRC Submission

041110-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10725548-10818704 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10751844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 242 (N242S)

Ref Sequence

ENSEMBL: ENSMUSP00000131712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]

AlphaFold

Q80SY4

Predicted Effect

probably benign
Transcript: ENSMUST00000052838
AA Change: N242S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: N242S

Domain	Start	End	E-Value	Type
Pfam:MIB_HERC2	15	72	5.6e-21	PFAM
ZnF_ZZ	79	124	1.01e-10	SMART
Pfam:MIB_HERC2	154	219	4.9e-31	PFAM
ANK	430	460	1.63e3	SMART
ANK	463	492	2.1e-3	SMART
ANK	496	525	2.47e2	SMART
ANK	529	558	6.02e-4	SMART
ANK	562	591	1.14e-4	SMART
ANK	595	626	6.26e-2	SMART
ANK	631	661	1.24e-5	SMART
ANK	665	694	9.27e-5	SMART
ANK	698	729	1.04e2	SMART
RING	819	853	1.8e-1	SMART
RING	866	900	1.9e-1	SMART
RING	963	995	4.58e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131073

Predicted Effect

probably benign
Transcript: ENSMUST00000165555
AA Change: N242S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: N242S

Domain	Start	End	E-Value	Type
Pfam:MIB_HERC2	15	74	5.7e-25	PFAM
ZnF_ZZ	79	124	1.01e-10	SMART
Pfam:MIB_HERC2	154	221	5.5e-31	PFAM
ANK	430	460	1.63e3	SMART
ANK	463	492	2.1e-3	SMART
ANK	496	525	2.47e2	SMART
ANK	529	558	6.02e-4	SMART
ANK	562	591	1.14e-4	SMART
ANK	595	626	6.26e-2	SMART
ANK	631	661	1.24e-5	SMART
ANK	665	694	9.27e-5	SMART
ANK	698	729	1.04e2	SMART
RING	819	853	1.8e-1	SMART
RING	866	900	1.9e-1	SMART
RING	963	995	4.58e-4	SMART

Meta Mutation Damage Score

0.0758

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk1	C	T	3: 127,729,373	V7M	probably damaging	Het
Birc6	T	A	17: 74,619,668		probably null	Het
Chil3	G	A	3: 106,160,499	Q117*	probably null	Het
Daglb	T	C	5: 143,473,134		probably benign	Het
Dnah11	G	A	12: 118,125,843	R1163*	probably null	Het
Ftsj3	G	A	11: 106,253,676	A134V	probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Gfod2	T	C	8: 105,717,545	N122S	possibly damaging	Het
Golga4	A	G	9: 118,551,878	E507G	probably benign	Het
Ids	C	A	X: 70,346,344	G506C	probably damaging	Het
Ifna15	G	T	4: 88,557,842	T135N	probably benign	Het
Igsf9b	G	A	9: 27,309,478	V47I	possibly damaging	Het
Kif24	A	G	4: 41,413,827		probably null	Het
L3hypdh	A	T	12: 72,077,424	D247E	probably damaging	Het
Lama2	A	T	10: 26,984,493	N2999K	probably damaging	Het
Lpcat2	C	A	8: 92,873,106	P234Q	probably benign	Het
Lrp10	C	T	14: 54,468,366	R338C	probably damaging	Het
Mcm9	A	C	10: 53,537,653	C444G	probably benign	Het
Mecom	G	A	3: 29,979,785	Q246*	probably null	Het
Olfr13	T	A	6: 43,174,226	M80K	probably damaging	Het
Olfr943	G	A	9: 39,184,568	C127Y	probably damaging	Het
P3h4	A	G	11: 100,413,626	F263S	probably damaging	Het
Pcsk1	T	C	13: 75,112,719	S354P	possibly damaging	Het
Pms2	T	A	5: 143,925,926	F617Y	probably damaging	Het
Prps2	T	A	X: 167,363,549	K176*	probably null	Het
Psmd13	G	T	7: 140,889,505		probably benign	Het
Pygl	G	A	12: 70,195,690	S573L	probably damaging	Het
Rapgef3	A	G	15: 97,748,648	V794A	probably benign	Het
Rasgrf2	C	A	13: 91,890,677	D1017Y	probably damaging	Het
Rb1cc1	A	G	1: 6,245,637	D555G	probably damaging	Het
Rptor	G	T	11: 119,671,345	E111D	probably damaging	Het
Sall4	T	C	2: 168,755,480	E480G	probably benign	Het
Scn4a	G	A	11: 106,348,857		probably null	Het
Scn8a	G	A	15: 100,940,133	A94T	probably benign	Het
Slc26a6	T	A	9: 108,861,783	C636S	probably benign	Het
Slc38a11	T	C	2: 65,358,116	K103R	probably benign	Het
Sned1	T	C	1: 93,274,659	L675P	probably benign	Het
Spsb1	T	C	4: 149,906,775	H112R	probably damaging	Het
Tmem132d	G	A	5: 127,984,341	T399M	possibly damaging	Het
Zfp939	A	G	7: 39,473,720		noncoding transcript	Het
Zfp951	T	C	5: 104,814,675	K342E	probably damaging	Het

Other mutations in Mib1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Mib1	APN	18	10798490	missense	probably benign	0.02
IGL02300:Mib1	APN	18	10741016	missense	probably damaging	1.00
IGL02701:Mib1	APN	18	10747357	missense	probably damaging	0.98
IGL02731:Mib1	APN	18	10800115	missense	possibly damaging	0.81
IGL03002:Mib1	APN	18	10798356	missense	possibly damaging	0.87
IGL03083:Mib1	APN	18	10752029	critical splice donor site	probably null
PIT4466001:Mib1	UTSW	18	10775541	missense	probably benign	0.01
PIT4468001:Mib1	UTSW	18	10798463	missense	possibly damaging	0.86
R0496:Mib1	UTSW	18	10804773	missense	probably benign
R1015:Mib1	UTSW	18	10726409	missense	probably damaging	1.00
R1237:Mib1	UTSW	18	10768149	missense	probably damaging	1.00
R1557:Mib1	UTSW	18	10798474	missense	probably damaging	1.00
R1918:Mib1	UTSW	18	10740972	splice site	probably null
R1952:Mib1	UTSW	18	10812077	missense	possibly damaging	0.94
R1982:Mib1	UTSW	18	10812064	missense	probably damaging	1.00
R2009:Mib1	UTSW	18	10812118	missense	probably damaging	1.00
R2372:Mib1	UTSW	18	10812045	missense	probably damaging	1.00
R2422:Mib1	UTSW	18	10751906	missense	probably damaging	1.00
R2922:Mib1	UTSW	18	10760831	nonsense	probably null
R2923:Mib1	UTSW	18	10760831	nonsense	probably null
R2938:Mib1	UTSW	18	10752033	splice site	probably benign
R3814:Mib1	UTSW	18	10763281	missense	probably benign	0.09
R3858:Mib1	UTSW	18	10798409	missense	possibly damaging	0.56
R4356:Mib1	UTSW	18	10751844	missense	probably benign	0.03
R4357:Mib1	UTSW	18	10751844	missense	probably benign	0.03
R4406:Mib1	UTSW	18	10763289	missense	probably damaging	1.00
R4497:Mib1	UTSW	18	10811985	missense	possibly damaging	0.75
R4593:Mib1	UTSW	18	10768191	missense	possibly damaging	0.89
R4623:Mib1	UTSW	18	10808086	missense	probably benign	0.02
R5068:Mib1	UTSW	18	10793002	missense	probably damaging	0.99
R5069:Mib1	UTSW	18	10793002	missense	probably damaging	0.99
R5070:Mib1	UTSW	18	10793002	missense	probably damaging	0.99
R5258:Mib1	UTSW	18	10795856	splice site	probably null
R5322:Mib1	UTSW	18	10792975	missense	probably damaging	1.00
R5589:Mib1	UTSW	18	10794488	missense	probably benign	0.00
R5622:Mib1	UTSW	18	10794503	missense	possibly damaging	0.90
R6401:Mib1	UTSW	18	10795802	missense	probably benign
R6928:Mib1	UTSW	18	10802282	missense	probably benign	0.02
R7242:Mib1	UTSW	18	10741011	missense	probably damaging	1.00
R7870:Mib1	UTSW	18	10798446	missense	possibly damaging	0.75
R7912:Mib1	UTSW	18	10778187	missense	probably damaging	1.00
R8127:Mib1	UTSW	18	10741031	missense	probably damaging	1.00
R8276:Mib1	UTSW	18	10751880	missense	possibly damaging	0.89
R8338:Mib1	UTSW	18	10726372	missense	probably benign	0.09
R8375:Mib1	UTSW	18	10768233	critical splice donor site	probably null
R8777:Mib1	UTSW	18	10747422	missense	probably benign	0.35
R8777-TAIL:Mib1	UTSW	18	10747422	missense	probably benign	0.35
R8811:Mib1	UTSW	18	10755643	missense	probably benign	0.00
R9057:Mib1	UTSW	18	10795728	missense	possibly damaging	0.90
R9117:Mib1	UTSW	18	10793023	missense	probably benign	0.00
R9170:Mib1	UTSW	18	10726437	missense	probably benign	0.02
R9252:Mib1	UTSW	18	10800088	missense	probably benign
R9256:Mib1	UTSW	18	10760862	missense	possibly damaging	0.80
R9323:Mib1	UTSW	18	10775685	missense	probably damaging	1.00
R9418:Mib1	UTSW	18	10812064	missense	probably damaging	1.00
R9581:Mib1	UTSW	18	10775701	missense	possibly damaging	0.61
R9701:Mib1	UTSW	18	10798494	missense	probably damaging	1.00
R9802:Mib1	UTSW	18	10798494	missense	probably damaging	1.00
Z1177:Mib1	UTSW	18	10763309	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTAACTTACAGCTGGATCTCATG -3'
(R):5'- TGCCACTTGGATACTGTACTACAATG -3'

Sequencing Primer
(F):5'- AACTGAGGGACCTTCTCTGAC -3'
(R):5'- GTCATGATCTTCATCAATGCCACAG -3'

Posted On

2015-06-24