Incidental Mutation 'R4358:Ids'
ID 324681
Institutional Source Beutler Lab
Gene Symbol Ids
Ensembl Gene ENSMUSG00000035847
Gene Name iduronate 2-sulfatase
Synonyms
MMRRC Submission 041110-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R4358 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 70343069-70365084 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70346344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 506 (G506C)
Ref Sequence ENSEMBL: ENSMUSP00000099046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101509]
AlphaFold Q08890
Predicted Effect probably damaging
Transcript: ENSMUST00000101509
AA Change: G506C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099046
Gene: ENSMUSG00000035847
AA Change: G506C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Sulfatase 39 418 9.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130519
SMART Domains Protein: ENSMUSP00000118732
Gene: ENSMUSG00000035847

DomainStartEndE-ValueType
Pfam:Sulfatase 2 236 7.2e-21 PFAM
Meta Mutation Damage Score 0.5095 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice with homozygous disruption of this gene display lysosomal accumulation of glycosaminoglycans in multiple tissues, premature death, impaired locomotor activity, joint swelling, and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
Birc6 T A 17: 74,619,668 probably null Het
Chil3 G A 3: 106,160,499 Q117* probably null Het
Daglb T C 5: 143,473,134 probably benign Het
Dnah11 G A 12: 118,125,843 R1163* probably null Het
Ftsj3 G A 11: 106,253,676 A134V probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Golga4 A G 9: 118,551,878 E507G probably benign Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
L3hypdh A T 12: 72,077,424 D247E probably damaging Het
Lama2 A T 10: 26,984,493 N2999K probably damaging Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Mcm9 A C 10: 53,537,653 C444G probably benign Het
Mecom G A 3: 29,979,785 Q246* probably null Het
Mib1 A G 18: 10,751,844 N242S probably benign Het
Olfr13 T A 6: 43,174,226 M80K probably damaging Het
Olfr943 G A 9: 39,184,568 C127Y probably damaging Het
P3h4 A G 11: 100,413,626 F263S probably damaging Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pms2 T A 5: 143,925,926 F617Y probably damaging Het
Prps2 T A X: 167,363,549 K176* probably null Het
Psmd13 G T 7: 140,889,505 probably benign Het
Pygl G A 12: 70,195,690 S573L probably damaging Het
Rapgef3 A G 15: 97,748,648 V794A probably benign Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Rb1cc1 A G 1: 6,245,637 D555G probably damaging Het
Rptor G T 11: 119,671,345 E111D probably damaging Het
Sall4 T C 2: 168,755,480 E480G probably benign Het
Scn4a G A 11: 106,348,857 probably null Het
Scn8a G A 15: 100,940,133 A94T probably benign Het
Slc26a6 T A 9: 108,861,783 C636S probably benign Het
Slc38a11 T C 2: 65,358,116 K103R probably benign Het
Sned1 T C 1: 93,274,659 L675P probably benign Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Tmem132d G A 5: 127,984,341 T399M possibly damaging Het
Zfp939 A G 7: 39,473,720 noncoding transcript Het
Zfp951 T C 5: 104,814,675 K342E probably damaging Het
Other mutations in Ids
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1081:Ids UTSW X 70361110 missense possibly damaging 0.63
R2853:Ids UTSW X 70353170 missense probably damaging 1.00
R4356:Ids UTSW X 70346344 missense probably damaging 0.99
R4357:Ids UTSW X 70346344 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACATATGTGCCCACTGAGG -3'
(R):5'- CATGTTGAGCTTTGCAGAGAAG -3'

Sequencing Primer
(F):5'- ACTGAGGCTGGCAGAACTC -3'
(R):5'- GAAGCATTTGCAGCTCCATG -3'
Posted On 2015-06-24