Incidental Mutation 'R4274:Dph7'
ID324685
Institutional Source Beutler Lab
Gene Symbol Dph7
Ensembl Gene ENSMUSG00000026975
Gene Namediphthamine biosynethesis 7
Synonyms2810443J12Rik, Wdr85
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24962400-24972163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24963500 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 109 (N109S)
Ref Sequence ENSEMBL: ENSMUSP00000028351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028350] [ENSMUST00000028351] [ENSMUST00000124383] [ENSMUST00000126909] [ENSMUST00000135339] [ENSMUST00000143253] [ENSMUST00000148042] [ENSMUST00000153375]
Predicted Effect probably benign
Transcript: ENSMUST00000028350
SMART Domains Protein: ENSMUSP00000028350
Gene: ENSMUSG00000026974

DomainStartEndE-ValueType
Pfam:HNH_3 66 105 1.9e-10 PFAM
Pfam:zf-MYND 167 212 1.2e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000028351
AA Change: N109S

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028351
Gene: ENSMUSG00000026975
AA Change: N109S

DomainStartEndE-ValueType
Blast:WD40 74 118 3e-10 BLAST
Blast:WD40 128 175 3e-15 BLAST
WD40 183 223 7.43e-1 SMART
WD40 227 267 1.08e-4 SMART
WD40 271 310 1.37e2 SMART
WD40 420 455 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124383
Predicted Effect probably benign
Transcript: ENSMUST00000126909
Predicted Effect probably benign
Transcript: ENSMUST00000135339
SMART Domains Protein: ENSMUSP00000142067
Gene: ENSMUSG00000026975

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143253
SMART Domains Protein: ENSMUSP00000142315
Gene: ENSMUSG00000026975

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146382
Predicted Effect probably benign
Transcript: ENSMUST00000148042
SMART Domains Protein: ENSMUSP00000141788
Gene: ENSMUSG00000026974

DomainStartEndE-ValueType
Pfam:HNH_3 27 66 1.4e-10 PFAM
Pfam:zf-MYND 124 173 5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153375
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diphthamide is a post-translationally modified histidine residue present in elongation factor 2, and is the target of diphtheria toxin. This gene encodes a protein that contains a WD-40 domain, and is thought to be involved in diphthamide biosynthesis. A similar protein in yeast functions as a methylesterase, converting methylated diphthine to diphthine, which can then undergo amidation to produce diphthamide. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Dph7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Dph7 APN 2 24971643 missense probably benign 0.00
IGL01021:Dph7 APN 2 24971923 unclassified probably null
IGL01322:Dph7 APN 2 24965617 missense possibly damaging 0.85
IGL02393:Dph7 APN 2 24966597 missense possibly damaging 0.89
IGL03286:Dph7 APN 2 24966616 missense probably damaging 1.00
R0614:Dph7 UTSW 2 24968956 critical splice donor site probably null
R1169:Dph7 UTSW 2 24966571 missense probably benign 0.06
R1696:Dph7 UTSW 2 24969680 critical splice donor site probably null
R2000:Dph7 UTSW 2 24971641 missense probably benign 0.03
R4738:Dph7 UTSW 2 24963131 missense possibly damaging 0.91
R4740:Dph7 UTSW 2 24963131 missense possibly damaging 0.91
R5475:Dph7 UTSW 2 24968957 splice site probably null
R6019:Dph7 UTSW 2 24963540 nonsense probably null
R6645:Dph7 UTSW 2 24965651 missense probably benign 0.02
R7443:Dph7 UTSW 2 24962493 missense probably benign
R7570:Dph7 UTSW 2 24965630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGAAAAGCCTTTGTTTGGAG -3'
(R):5'- GTGTCCTCATCTCACAAGAACC -3'

Sequencing Primer
(F):5'- GACAACAGTTGGCTCTAGTTTG -3'
(R):5'- AAAGAGATCTGCTTGCCTCTG -3'
Posted On2015-06-24