Incidental Mutation 'R4274:Vmn2r125'
ID324696
Institutional Source Beutler Lab
Gene Symbol Vmn2r125
Ensembl Gene ENSMUSG00000096042
Gene Namevomeronasal 2, receptor 125
SynonymsGm20782
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156349921-156354578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156350087 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 56 (I56T)
Ref Sequence ENSEMBL: ENSMUSP00000094556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096794]
Predicted Effect probably benign
Transcript: ENSMUST00000096794
AA Change: I56T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000094556
Gene: ENSMUSG00000096042
AA Change: I56T

DomainStartEndE-ValueType
Pfam:ANF_receptor 9 355 7e-32 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Vmn2r125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r125 APN 4 156351226 missense probably benign
IGL00990:Vmn2r125 APN 4 156351383 missense probably benign 0.00
IGL00990:Vmn2r125 APN 4 156350966 missense probably benign 0.01
IGL00990:Vmn2r125 APN 4 156350900 missense probably benign 0.35
IGL00990:Vmn2r125 APN 4 156350899 missense probably benign
IGL00990:Vmn2r125 APN 4 156351038 missense probably benign 0.06
IGL00990:Vmn2r125 APN 4 156351037 missense probably benign 0.16
IGL01018:Vmn2r125 APN 4 156351226 missense probably benign
IGL01018:Vmn2r125 APN 4 156351038 missense probably benign 0.06
IGL01018:Vmn2r125 APN 4 156351037 missense probably benign 0.16
IGL01018:Vmn2r125 APN 4 156350900 missense probably benign 0.35
IGL01018:Vmn2r125 APN 4 156350899 missense probably benign
IGL01018:Vmn2r125 APN 4 156350845 missense probably damaging 1.00
IGL01018:Vmn2r125 APN 4 156350612 splice site probably benign
IGL02644:Vmn2r125 APN 4 156350999 missense probably benign 0.01
IGL03144:Vmn2r125 APN 4 156350019 missense possibly damaging 0.76
FR4342:Vmn2r125 UTSW 4 156350965 missense probably benign 0.01
R0408:Vmn2r125 UTSW 4 156350858 missense probably damaging 0.99
R0785:Vmn2r125 UTSW 4 156351101 missense probably benign
R1185:Vmn2r125 UTSW 4 156351101 missense probably benign
R1530:Vmn2r125 UTSW 4 156351152 missense probably damaging 1.00
R1698:Vmn2r125 UTSW 4 156351038 missense probably benign 0.06
R1780:Vmn2r125 UTSW 4 156351373 missense probably damaging 1.00
R1977:Vmn2r125 UTSW 4 156354591 unclassified probably null
R2917:Vmn2r125 UTSW 4 156351269 missense probably benign 0.01
R3428:Vmn2r125 UTSW 4 156350141 missense probably benign 0.34
R3712:Vmn2r125 UTSW 4 156350124 nonsense probably null
R4575:Vmn2r125 UTSW 4 156349977 missense probably null 0.30
R4707:Vmn2r125 UTSW 4 156349981 missense probably damaging 1.00
R5229:Vmn2r125 UTSW 4 156351038 missense probably benign 0.06
R5504:Vmn2r125 UTSW 4 156351161 missense possibly damaging 0.81
R5587:Vmn2r125 UTSW 4 156350138 missense probably damaging 1.00
R5987:Vmn2r125 UTSW 4 156349997 missense probably damaging 1.00
R6037:Vmn2r125 UTSW 4 156351101 missense probably benign
R6183:Vmn2r125 UTSW 4 156350069 missense probably damaging 0.97
R6456:Vmn2r125 UTSW 4 156351062 missense probably benign 0.41
R7342:Vmn2r125 UTSW 4 156350843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAAGGATGGCATTCAGC -3'
(R):5'- AAGTTTCCTTCTAGGCACCTG -3'

Sequencing Primer
(F):5'- AAACATCTCCCTTAATCATCACTTTG -3'
(R):5'- TGAAGAGTCCATTGCCA -3'
Posted On2015-06-24