Incidental Mutation 'R4274:Rtn2'
ID324703
Institutional Source Beutler Lab
Gene Symbol Rtn2
Ensembl Gene ENSMUSG00000030401
Gene Namereticulon 2 (Z-band associated protein)
SynonymsNspl1
MMRRC Submission 041077-MU
Accession Numbers

Genbank: NM_013648, NM_001025364

Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R4274 (G1)
Quality Score190
Status Validated
Chromosome7
Chromosomal Location19282624-19296160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19287324 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 210 (S210P)
Ref Sequence ENSEMBL: ENSMUSP00000032559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032559] [ENSMUST00000108468]
Predicted Effect probably benign
Transcript: ENSMUST00000032559
AA Change: S210P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032559
Gene: ENSMUSG00000030401
AA Change: S210P

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 70 85 N/A INTRINSIC
low complexity region 119 144 N/A INTRINSIC
Pfam:Reticulon 272 436 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108468
SMART Domains Protein: ENSMUSP00000104108
Gene: ENSMUSG00000030401

DomainStartEndE-ValueType
Pfam:Reticulon 5 175 3.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209186
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are necessary for proper generation of tubular endoplasmic reticulum and likely play a role in intracellular vesicular transport. Alternatively spliced transcript variants encoding different isoforms have been identified. Mutations at this locus have been associated with autosomal dominant spastic paraplegia-12. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice heterozygous and homozygous for an allele disrupting the skeletal isoform exhibit abollished or severely impaired glucose uptake in skeletal muscle. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Rtn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Rtn2 APN 7 19293111 missense probably damaging 1.00
G5030:Rtn2 UTSW 7 19293174 missense probably damaging 1.00
R0067:Rtn2 UTSW 7 19294471 splice site probably benign
R2036:Rtn2 UTSW 7 19293739 missense probably damaging 1.00
R2240:Rtn2 UTSW 7 19286829 unclassified probably null
R4111:Rtn2 UTSW 7 19286844 missense probably damaging 1.00
R4678:Rtn2 UTSW 7 19293895 missense probably damaging 1.00
R6667:Rtn2 UTSW 7 19287259 missense probably benign 0.01
Z1177:Rtn2 UTSW 7 19287477 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCTGGAAAATGAGGAGCC -3'
(R):5'- GAGCGGCTCCAACATGAATTC -3'

Sequencing Primer
(F):5'- CCTGATGGATTGGAGGCCAG -3'
(R):5'- CGGCTCCAACATGAATTCTGATTGG -3'
Posted On2015-06-24