Incidental Mutation 'R4274:Zfp82'
ID324704
Institutional Source Beutler Lab
Gene Symbol Zfp82
Ensembl Gene ENSMUSG00000098022
Gene Namezinc finger protein 82
SynonymsKRAB16
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30054489-30072900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30056367 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 430 (R430H)
Ref Sequence ENSEMBL: ENSMUSP00000138217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080834] [ENSMUST00000182546] [ENSMUST00000182746] [ENSMUST00000182919] [ENSMUST00000183115] [ENSMUST00000183190] [ENSMUST00000207072] [ENSMUST00000207873]
Predicted Effect probably damaging
Transcript: ENSMUST00000080834
AA Change: R460H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079647
Gene: ENSMUSG00000098022
AA Change: R460H

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
ZnF_C2H2 168 190 1.1e-2 SMART
ZnF_C2H2 196 218 1.69e-3 SMART
ZnF_C2H2 224 246 1.79e-2 SMART
ZnF_C2H2 252 274 4.24e-4 SMART
ZnF_C2H2 280 300 5.2e0 SMART
ZnF_C2H2 308 330 7.05e-1 SMART
ZnF_C2H2 336 358 1.2e-3 SMART
ZnF_C2H2 364 386 3.63e-3 SMART
ZnF_C2H2 392 414 4.47e-3 SMART
ZnF_C2H2 420 442 1.79e-2 SMART
ZnF_C2H2 448 470 5.5e-3 SMART
ZnF_C2H2 476 498 5.9e-3 SMART
ZnF_C2H2 504 526 1.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182483
Predicted Effect probably damaging
Transcript: ENSMUST00000182546
AA Change: R430H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138217
Gene: ENSMUSG00000098022
AA Change: R430H

DomainStartEndE-ValueType
KRAB 6 62 5.01e-15 SMART
ZnF_C2H2 138 160 1.1e-2 SMART
ZnF_C2H2 166 188 1.69e-3 SMART
ZnF_C2H2 194 216 1.79e-2 SMART
ZnF_C2H2 222 244 4.24e-4 SMART
ZnF_C2H2 250 270 5.2e0 SMART
ZnF_C2H2 278 300 7.05e-1 SMART
ZnF_C2H2 306 328 1.2e-3 SMART
ZnF_C2H2 334 356 3.63e-3 SMART
ZnF_C2H2 362 384 4.47e-3 SMART
ZnF_C2H2 390 412 1.79e-2 SMART
ZnF_C2H2 418 440 5.5e-3 SMART
ZnF_C2H2 446 468 5.9e-3 SMART
ZnF_C2H2 474 496 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182746
SMART Domains Protein: ENSMUSP00000138567
Gene: ENSMUSG00000058447

DomainStartEndE-ValueType
KRAB 6 56 1.44e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183025
Predicted Effect probably benign
Transcript: ENSMUST00000183115
Predicted Effect probably benign
Transcript: ENSMUST00000183190
SMART Domains Protein: ENSMUSP00000138469
Gene: ENSMUSG00000098022

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207072
Predicted Effect probably benign
Transcript: ENSMUST00000207873
Meta Mutation Damage Score 0.3647 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Zfp82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Zfp82 APN 7 30066330 missense probably damaging 1.00
IGL03030:Zfp82 APN 7 30057465 missense probably benign 0.00
PIT4142001:Zfp82 UTSW 7 30057276 missense probably damaging 1.00
R0432:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0513:Zfp82 UTSW 7 30056840 missense probably damaging 1.00
R0659:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0959:Zfp82 UTSW 7 30056451 missense probably damaging 1.00
R1510:Zfp82 UTSW 7 30056622 missense probably damaging 1.00
R1697:Zfp82 UTSW 7 30057354 missense probably benign
R2198:Zfp82 UTSW 7 30057511 missense probably benign
R2892:Zfp82 UTSW 7 30056439 missense probably damaging 1.00
R4932:Zfp82 UTSW 7 30056887 unclassified probably null
R5377:Zfp82 UTSW 7 30057166 missense probably damaging 1.00
R5677:Zfp82 UTSW 7 30057124 missense probably benign 0.43
R6822:Zfp82 UTSW 7 30056287 missense probably damaging 1.00
R7146:Zfp82 UTSW 7 30056167 missense probably benign
R7163:Zfp82 UTSW 7 30062244 missense probably benign
R7450:Zfp82 UTSW 7 30056895 missense probably damaging 1.00
R7476:Zfp82 UTSW 7 30056172 missense possibly damaging 0.69
R7627:Zfp82 UTSW 7 30056722 missense probably damaging 1.00
R7631:Zfp82 UTSW 7 30056426 missense probably damaging 1.00
R8025:Zfp82 UTSW 7 30056853 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAGAATGTTGTCTAAAGGCC -3'
(R):5'- GTCGACAGACTGTACGAGTG -3'

Sequencing Primer
(F):5'- ATGTTGTCTAAAGGCCTTCTTACAC -3'
(R):5'- CGTTTAGAGTTCGACAGCAGCTAAC -3'
Posted On2015-06-24