Incidental Mutation 'R4274:Atp13a1'
ID324712
Institutional Source Beutler Lab
Gene Symbol Atp13a1
Ensembl Gene ENSMUSG00000031862
Gene NameATPase type 13A1
SynonymsCgi152, Atp13a, catp
MMRRC Submission 041077-MU
Accession Numbers

Ncbi RefSeq: NM_133224.2; MGI: 2180801

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location69791163-69807749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 69805292 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 899 (L899R)
Ref Sequence ENSEMBL: ENSMUSP00000034326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034326] [ENSMUST00000036074] [ENSMUST00000123453]
Predicted Effect probably benign
Transcript: ENSMUST00000034326
AA Change: L899R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034326
Gene: ENSMUSG00000031862
AA Change: L899R

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Pfam:E1-E2_ATPase 264 515 3.2e-24 PFAM
Pfam:Hydrolase 524 781 2.2e-11 PFAM
Pfam:HAD 527 870 2.7e-27 PFAM
low complexity region 883 894 N/A INTRINSIC
transmembrane domain 1045 1067 N/A INTRINSIC
transmembrane domain 1093 1115 N/A INTRINSIC
transmembrane domain 1130 1147 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036074
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123453
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Meta Mutation Damage Score 0.2234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Atp13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Atp13a1 APN 8 69796897 missense probably damaging 1.00
IGL00949:Atp13a1 APN 8 69800003 splice site probably benign
IGL01122:Atp13a1 APN 8 69798905 missense probably damaging 1.00
IGL02399:Atp13a1 APN 8 69807101 missense probably damaging 1.00
IGL02616:Atp13a1 APN 8 69805313 missense probably benign
IGL03073:Atp13a1 APN 8 69798502 missense probably damaging 1.00
yun_nan UTSW 8 69798679 missense probably damaging 1.00
P0005:Atp13a1 UTSW 8 69803747 missense possibly damaging 0.88
R0086:Atp13a1 UTSW 8 69797774 missense possibly damaging 0.86
R0384:Atp13a1 UTSW 8 69797324 missense possibly damaging 0.89
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0974:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R2010:Atp13a1 UTSW 8 69791360 missense possibly damaging 0.77
R2040:Atp13a1 UTSW 8 69807052 missense possibly damaging 0.76
R2069:Atp13a1 UTSW 8 69799773 missense probably benign 0.00
R4288:Atp13a1 UTSW 8 69794078 missense possibly damaging 0.89
R4470:Atp13a1 UTSW 8 69798679 missense probably damaging 1.00
R5408:Atp13a1 UTSW 8 69796840 missense probably benign 0.41
R5916:Atp13a1 UTSW 8 69807098 missense probably damaging 1.00
R5920:Atp13a1 UTSW 8 69800096 missense probably benign 0.02
R5951:Atp13a1 UTSW 8 69797285 missense probably damaging 1.00
R6143:Atp13a1 UTSW 8 69805360 missense probably benign
R6467:Atp13a1 UTSW 8 69806774 missense probably damaging 1.00
R6487:Atp13a1 UTSW 8 69799878 missense probably damaging 0.99
R7166:Atp13a1 UTSW 8 69799316 splice site probably null
R7652:Atp13a1 UTSW 8 69805559 missense probably damaging 0.97
R8014:Atp13a1 UTSW 8 69799779 nonsense probably null
RF001:Atp13a1 UTSW 8 69800070 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGAGAGTACCTTGGAACTGGTG -3'
(R):5'- ACTGGATGGAGGACAGCTTG -3'

Sequencing Primer
(F):5'- ACCTTGGAACTGGTGGCAGG -3'
(R):5'- TGCTGCGATGCTGGCATC -3'
Posted On2015-06-24