Incidental Mutation 'R4274:Foxc2'
ID324719
Institutional Source Beutler Lab
Gene Symbol Foxc2
Ensembl Gene ENSMUSG00000046714
Gene Nameforkhead box C2
SynonymsMfh1, Fkh14, MFH-1, Hfhbf3
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4274 (G1)
Quality Score111
Status Validated
Chromosome8
Chromosomal Location121116171-121118895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121117700 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 362 (S362R)
Ref Sequence ENSEMBL: ENSMUSP00000055290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054691] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000054691
AA Change: S362R

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055290
Gene: ENSMUSG00000046714
AA Change: S362R

DomainStartEndE-ValueType
FH 69 159 2.11e-63 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 203 220 N/A INTRINSIC
low complexity region 288 312 N/A INTRINSIC
low complexity region 379 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.0849 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the development of mesenchymal tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die perinatally or before with cardiac abnormalities and skeletal defects in the neurocranium and spine. Heterozygotes exhibit lymphatic vessel and lymph node hyperplasia, anterior segment defects, and distichiasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Foxc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Foxc2 APN 8 121117837 missense probably benign 0.10
IGL02973:Foxc2 APN 8 121118049 missense probably benign
R0211:Foxc2 UTSW 8 121116616 start codon destroyed probably null 0.77
R0477:Foxc2 UTSW 8 121118035 missense probably damaging 0.99
R1589:Foxc2 UTSW 8 121117176 missense probably benign
R1859:Foxc2 UTSW 8 121116625 missense probably damaging 0.98
R1965:Foxc2 UTSW 8 121116674 missense probably damaging 0.99
R2104:Foxc2 UTSW 8 121118080 missense probably damaging 1.00
R4392:Foxc2 UTSW 8 121117452 missense probably damaging 0.98
R7678:Foxc2 UTSW 8 121118095 missense probably damaging 1.00
R7707:Foxc2 UTSW 8 121117902 missense probably benign 0.00
Z1088:Foxc2 UTSW 8 121116959 missense possibly damaging 0.95
Z1088:Foxc2 UTSW 8 121117150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGTGGAGACCATCATGAC -3'
(R):5'- TGAACATCTCCCGGACGTTG -3'

Sequencing Primer
(F):5'- TGGAGACCATCATGACGCTGC -3'
(R):5'- TTGCAAACGTGTGGCCG -3'
Posted On2015-06-24