Incidental Mutation 'R4274:Olfr160'
ID324720
Institutional Source Beutler Lab
Gene Symbol Olfr160
Ensembl Gene ENSMUSG00000061165
Gene Nameolfactory receptor 160
SynonymsGA_x6K02T2PVTD-31389446-31388517, MOR171-3, M72, MOR171-3
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37708964-37716250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37712068 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 70 (D70E)
Ref Sequence ENSEMBL: ENSMUSP00000151178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104875] [ENSMUST00000211952] [ENSMUST00000215727]
Predicted Effect probably damaging
Transcript: ENSMUST00000104875
AA Change: D70E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100468
Gene: ENSMUSG00000061165
AA Change: D70E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.5e-48 PFAM
Pfam:7tm_1 41 290 6.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211952
AA Change: D70E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215727
AA Change: D70E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2568 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele respond heterogeneously to odorants and display abnormal innervation of glomeruli by olfactory sensory axons in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Olfr160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Olfr160 APN 9 37711836 missense probably damaging 0.98
IGL02195:Olfr160 APN 9 37712121 missense probably benign
R0099:Olfr160 UTSW 9 37711454 missense probably damaging 0.99
R0124:Olfr160 UTSW 9 37711463 missense possibly damaging 0.79
R0129:Olfr160 UTSW 9 37711940 missense probably damaging 1.00
R0882:Olfr160 UTSW 9 37711872 missense probably benign 0.02
R1855:Olfr160 UTSW 9 37711970 missense possibly damaging 0.92
R1988:Olfr160 UTSW 9 37711697 missense possibly damaging 0.50
R2346:Olfr160 UTSW 9 37711365 missense possibly damaging 0.50
R4164:Olfr160 UTSW 9 37711698 missense probably benign 0.03
R4504:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R4505:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R4506:Olfr160 UTSW 9 37711464 missense probably benign 0.03
R5017:Olfr160 UTSW 9 37711525 nonsense probably null
R5268:Olfr160 UTSW 9 37712004 missense probably damaging 1.00
R5316:Olfr160 UTSW 9 37711685 missense possibly damaging 0.90
R5372:Olfr160 UTSW 9 37711938 missense possibly damaging 0.49
R5385:Olfr160 UTSW 9 37712021 missense probably damaging 1.00
R5822:Olfr160 UTSW 9 37711791 missense probably benign 0.01
R5906:Olfr160 UTSW 9 37711805 missense probably benign 0.23
R5990:Olfr160 UTSW 9 37712110 missense probably damaging 0.99
R6842:Olfr160 UTSW 9 37711589 missense probably benign
R7712:Olfr160 UTSW 9 37712133 missense probably damaging 1.00
Z1177:Olfr160 UTSW 9 37711564 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGGGTTGACAGATGGCCAC -3'
(R):5'- CACCCAGATACAATGGCTGCAG -3'

Sequencing Primer
(F):5'- TGGCCACATAGCGGTCATAG -3'
(R):5'- CAGAGTTTATCCTCAGAGGGCTAAC -3'
Posted On2015-06-24