Incidental Mutation 'R4274:Fam83g'
ID324723
Institutional Source Beutler Lab
Gene Symbol Fam83g
Ensembl Gene ENSMUSG00000042377
Gene Namefamily with sequence similarity 83, member G
Synonyms
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61684091-61709951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61701728 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 259 (M259T)
Ref Sequence ENSEMBL: ENSMUSP00000090697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051552] [ENSMUST00000093019] [ENSMUST00000148584] [ENSMUST00000151780]
Predicted Effect probably benign
Transcript: ENSMUST00000051552
SMART Domains Protein: ENSMUSP00000054407
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093019
AA Change: M259T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090697
Gene: ENSMUSG00000042377
AA Change: M259T

DomainStartEndE-ValueType
Pfam:DUF1669 15 309 1.8e-120 PFAM
Pfam:PLDc_2 165 304 5.5e-11 PFAM
low complexity region 316 336 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
low complexity region 721 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128196
Predicted Effect probably benign
Transcript: ENSMUST00000148584
SMART Domains Protein: ENSMUSP00000114523
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151780
SMART Domains Protein: ENSMUSP00000118196
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 48 185 3.5e-44 PFAM
Pfam:SSF 182 450 5e-79 PFAM
transmembrane domain 484 506 N/A INTRINSIC
transmembrane domain 547 566 N/A INTRINSIC
Meta Mutation Damage Score 0.7033 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mutations at this locus result in curly hair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Fam83g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Fam83g APN 11 61684783 missense probably benign 0.00
IGL02958:Fam83g APN 11 61707722 missense probably damaging 1.00
PIT4402001:Fam83g UTSW 11 61703596 missense probably damaging 0.99
R0365:Fam83g UTSW 11 61703109 nonsense probably null
R0410:Fam83g UTSW 11 61703392 missense probably damaging 1.00
R0555:Fam83g UTSW 11 61707663 missense probably benign 0.37
R1163:Fam83g UTSW 11 61703436 missense probably damaging 1.00
R1413:Fam83g UTSW 11 61702678 missense probably damaging 1.00
R1474:Fam83g UTSW 11 61702993 missense probably damaging 1.00
R1916:Fam83g UTSW 11 61695168 missense probably damaging 1.00
R2006:Fam83g UTSW 11 61702975 missense possibly damaging 0.94
R2105:Fam83g UTSW 11 61703458 missense probably benign 0.01
R2134:Fam83g UTSW 11 61703684 missense probably benign 0.00
R2968:Fam83g UTSW 11 61703478 missense probably damaging 0.97
R4753:Fam83g UTSW 11 61695269 missense probably damaging 1.00
R5888:Fam83g UTSW 11 61702594 missense probably benign 0.38
R6280:Fam83g UTSW 11 61703182 missense probably benign 0.00
R7234:Fam83g UTSW 11 61702516 missense possibly damaging 0.75
R7257:Fam83g UTSW 11 61684753 missense probably damaging 1.00
R7588:Fam83g UTSW 11 61684696 missense probably damaging 1.00
R7761:Fam83g UTSW 11 61684758 missense possibly damaging 0.90
Z1176:Fam83g UTSW 11 61707470 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATGCCTACACACTGCCTG -3'
(R):5'- TTGGACAAAAGGCTTCCCTG -3'

Sequencing Primer
(F):5'- CTGTGGGCTCTGGACAGTC -3'
(R):5'- TGCCTGCCTCCACAGATG -3'
Posted On2015-06-24