Incidental Mutation 'R4274:Tnpo1'
ID324728
Institutional Source Beutler Lab
Gene Symbol Tnpo1
Ensembl Gene ENSMUSG00000009470
Gene Nametransportin 1
SynonymsKpnb2, D13Ertd688e
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4274 (G1)
Quality Score217
Status Validated
Chromosome13
Chromosomal Location98839019-98926384 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC at 98867129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109399] [ENSMUST00000109401] [ENSMUST00000179301]
Predicted Effect probably null
Transcript: ENSMUST00000109399
SMART Domains Protein: ENSMUSP00000105026
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.7e-12 PFAM
Pfam:HEAT 439 469 6.8e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109401
SMART Domains Protein: ENSMUSP00000105028
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 41 109 1.53e-6 SMART
low complexity region 358 376 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Pfam:HEAT_EZ 419 473 6.6e-15 PFAM
Pfam:HEAT 447 477 1.3e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179301
SMART Domains Protein: ENSMUSP00000136917
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.2e-12 PFAM
Pfam:HEAT 439 469 6.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224099
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the karyopherin receptor complex which interacts with nuclear localization signals to target nuclear proteins to the nucleus. The karyopherin receptor complex is a heterodimer of an alpha subunit which recognizes the nuclear localization signal and a beta subunit which docks the complex at nucleoporins. Alternate splicing of this gene results in two transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Tnpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Tnpo1 APN 13 98850104 splice site probably benign
IGL02572:Tnpo1 APN 13 98849159 missense probably damaging 1.00
IGL03040:Tnpo1 APN 13 98859955 missense probably damaging 0.99
IGL03237:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03379:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03393:Tnpo1 APN 13 98888473 missense probably damaging 0.99
IGL03405:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03407:Tnpo1 APN 13 98863840 missense probably damaging 0.98
Domineight UTSW 13 98867129 frame shift probably null
invert UTSW 13 98855446 missense probably damaging 1.00
R0308:Tnpo1 UTSW 13 98846503 missense probably damaging 0.97
R0465:Tnpo1 UTSW 13 98884634 missense probably damaging 0.97
R0492:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0707:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0732:Tnpo1 UTSW 13 98863812 missense probably damaging 0.99
R1314:Tnpo1 UTSW 13 98860722 missense probably damaging 0.99
R1449:Tnpo1 UTSW 13 98878712 missense probably damaging 0.99
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1488:Tnpo1 UTSW 13 98856907 missense probably damaging 0.98
R1961:Tnpo1 UTSW 13 98852932 missense probably damaging 1.00
R3123:Tnpo1 UTSW 13 98867129 frame shift probably null
R3124:Tnpo1 UTSW 13 98867129 frame shift probably null
R4151:Tnpo1 UTSW 13 98852899 missense probably damaging 1.00
R4272:Tnpo1 UTSW 13 98867129 frame shift probably null
R5154:Tnpo1 UTSW 13 98870305 missense possibly damaging 0.84
R5763:Tnpo1 UTSW 13 98859937 missense possibly damaging 0.54
R5765:Tnpo1 UTSW 13 98859841 missense probably benign 0.08
R5827:Tnpo1 UTSW 13 98856908 missense probably damaging 1.00
R6240:Tnpo1 UTSW 13 98863829 missense probably damaging 1.00
R6279:Tnpo1 UTSW 13 98890708 missense possibly damaging 0.90
R6294:Tnpo1 UTSW 13 98890774 missense probably benign 0.03
R7055:Tnpo1 UTSW 13 98855479 missense possibly damaging 0.85
R7509:Tnpo1 UTSW 13 98870243 missense probably benign 0.00
R7707:Tnpo1 UTSW 13 98890787 missense probably benign 0.00
Z1088:Tnpo1 UTSW 13 98860670 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATGATGAGCAAAACCTAGTCTC -3'
(R):5'- CCCCAGATGTGTATGTGCAC -3'

Sequencing Primer
(F):5'- GTTTAAATAATTCCTCCACCGGGCAG -3'
(R):5'- TGTATGTGCACAAAGGAGTTCC -3'
Posted On2015-06-24