Incidental Mutation 'R4274:Adamts6'
ID324729
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonymsb2b2187.1Clo, b2b2182Clo, ADAM-TS6, b2b2029Clo, b2b1879.1Clo, b2b2228Clo, A930019D11Rik
MMRRC Submission 041077-MU
Accession Numbers

NCBI RefSeq: NM_001081020.1; MGI: 1347348

Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104287835-104496695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104314279 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 323 (D323E)
Ref Sequence ENSEMBL: ENSMUSP00000153359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224504] [ENSMUST00000224742] [ENSMUST00000224784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065766
AA Change: D323E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: D323E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223562
AA Change: D323E

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224208
AA Change: D323E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224504
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect possibly damaging
Transcript: ENSMUST00000224784
AA Change: D323E

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0984 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104429790 missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104297218 nonsense probably null
IGL01305:Adamts6 APN 13 104390082 missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104297164 missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104390192 splice site probably benign
IGL01678:Adamts6 APN 13 104313688 missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104390135 missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104313660 missense probably null 1.00
IGL02217:Adamts6 APN 13 104462365 splice site probably benign
IGL02828:Adamts6 APN 13 104297470 missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104297275 missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104444956 utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104444215 missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104314334 missense possibly damaging 0.77
ANU22:Adamts6 UTSW 13 104390082 missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104297491 missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104390076 critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104426930 splice site probably benign
R0549:Adamts6 UTSW 13 104297255 missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104444927 missense probably benign 0.00
R0703:Adamts6 UTSW 13 104352847 missense probably damaging 1.00
R0799:Adamts6 UTSW 13 104314271 missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104413789 missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104312881 missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104493637 missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104444875 missense probably benign 0.26
R1619:Adamts6 UTSW 13 104312777 missense probably benign 0.14
R1727:Adamts6 UTSW 13 104428964 splice site probably benign
R1967:Adamts6 UTSW 13 104426951 nonsense probably null
R2013:Adamts6 UTSW 13 104314304 missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104462238 missense probably benign 0.00
R2432:Adamts6 UTSW 13 104426977 missense probably benign 0.01
R3118:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104312904 missense probably damaging 1.00
R4795:Adamts6 UTSW 13 104444128 nonsense probably null
R4841:Adamts6 UTSW 13 104312787 missense probably benign 0.00
R4976:Adamts6 UTSW 13 104297490 missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104307243 missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104493622 missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104352815 missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104347350 missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104479535 missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104297425 missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104347392 critical splice donor site probably null
R6243:Adamts6 UTSW 13 104314301 missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104462282 missense probably benign
R6743:Adamts6 UTSW 13 104428928 missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104313652 missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104312759 missense probably benign
R7351:Adamts6 UTSW 13 104390112 missense possibly damaging 0.63
R7520:Adamts6 UTSW 13 104297186 missense probably benign 0.01
R7866:Adamts6 UTSW 13 104413749 nonsense probably null
R7949:Adamts6 UTSW 13 104413749 nonsense probably null
X0065:Adamts6 UTSW 13 104493628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTAGGTCAGATGTTCTGGAG -3'
(R):5'- CTTCCTATCCCTTATTACCTGAAAGAG -3'

Sequencing Primer
(F):5'- ATGTTCTGGAGATAAAAATCGGC -3'
(R):5'- CCTGAAAGAGGTGTAGAGAAAACC -3'
Posted On2015-06-24