Incidental Mutation 'R4275:Fam126b'
ID324740
Institutional Source Beutler Lab
Gene Symbol Fam126b
Ensembl Gene ENSMUSG00000038174
Gene Namefamily with sequence similarity 126, member B
SynonymsD1Ertd53e
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R4275 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58522806-58586323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58529933 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 440 (T440A)
Ref Sequence ENSEMBL: ENSMUSP00000123728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038372] [ENSMUST00000097724] [ENSMUST00000161600] [ENSMUST00000187717]
Predicted Effect probably benign
Transcript: ENSMUST00000038372
AA Change: T440A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038718
Gene: ENSMUSG00000038174
AA Change: T440A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097724
AA Change: T496A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095331
Gene: ENSMUSG00000038174
AA Change: T496A

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 3.3e-126 PFAM
low complexity region 374 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161600
AA Change: T440A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123728
Gene: ENSMUSG00000038174
AA Change: T440A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187717
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Fam126b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Fam126b APN 1 58540253 splice site probably benign
IGL00468:Fam126b APN 1 58530232 missense probably benign 0.25
IGL00701:Fam126b APN 1 58535482 missense possibly damaging 0.59
IGL00795:Fam126b APN 1 58552179 missense probably damaging 1.00
IGL02023:Fam126b APN 1 58530115 missense possibly damaging 0.53
IGL02501:Fam126b APN 1 58540191 missense probably damaging 1.00
IGL02657:Fam126b APN 1 58535402 missense probably damaging 1.00
IGL02970:Fam126b APN 1 58539617 missense probably damaging 1.00
IGL03221:Fam126b APN 1 58540186 missense probably benign 0.00
IGL03240:Fam126b APN 1 58529917 missense probably damaging 1.00
PIT4812001:Fam126b UTSW 1 58548703 missense possibly damaging 0.78
R0455:Fam126b UTSW 1 58534479 splice site probably benign
R1479:Fam126b UTSW 1 58552268 nonsense probably null
R1529:Fam126b UTSW 1 58539607 missense probably benign 0.00
R5164:Fam126b UTSW 1 58535438 missense probably benign 0.13
R6332:Fam126b UTSW 1 58529875 missense probably damaging 0.99
R6352:Fam126b UTSW 1 58557312 missense probably damaging 1.00
R6549:Fam126b UTSW 1 58539600 missense probably benign 0.03
R7034:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7036:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7100:Fam126b UTSW 1 58534494 missense possibly damaging 0.94
R7237:Fam126b UTSW 1 58529948 nonsense probably null
R7378:Fam126b UTSW 1 58530034 missense probably benign 0.00
R7403:Fam126b UTSW 1 58548702 missense possibly damaging 0.59
R8015:Fam126b UTSW 1 58535482 missense possibly damaging 0.59
R8249:Fam126b UTSW 1 58534637 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTAGCCGGTCTTCTTGTAGACTG -3'
(R):5'- TTAGCAGCCAACCACATGGG -3'

Sequencing Primer
(F):5'- AACCCCAATGCTGGTACT -3'
(R):5'- AAGTAGCAACTGGGCGTTCC -3'
Posted On2015-06-24