Incidental Mutation 'R4275:Olfr996'
ID 324743
Institutional Source Beutler Lab
Gene Symbol Olfr996
Ensembl Gene ENSMUSG00000111179
Gene Name olfactory receptor 996
Synonyms GA_x6K02T2Q125-47058060-47059004, MOR175-4
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85579215-85580282 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85579863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000076330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077075]
AlphaFold Q7TRA0
Predicted Effect probably benign
Transcript: ENSMUST00000077075
AA Change: V208A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076330
Gene: ENSMUSG00000111179
AA Change: V208A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-52 PFAM
Pfam:7tm_1 41 290 2.7e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Olfr996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Olfr996 APN 2 85579531 nonsense probably null
IGL01972:Olfr996 APN 2 85579773 missense probably damaging 1.00
IGL02102:Olfr996 APN 2 85579673 missense probably damaging 0.98
IGL03159:Olfr996 APN 2 85579940 missense probably damaging 0.99
R0539:Olfr996 UTSW 2 85579775 missense probably damaging 0.99
R4561:Olfr996 UTSW 2 85579620 missense probably damaging 0.99
R4953:Olfr996 UTSW 2 85579725 nonsense probably null
R5794:Olfr996 UTSW 2 85579341 missense probably benign 0.03
R6061:Olfr996 UTSW 2 85579542 missense possibly damaging 0.48
R6695:Olfr996 UTSW 2 85579449 missense probably damaging 1.00
R6981:Olfr996 UTSW 2 85579481 missense probably benign 0.06
R7030:Olfr996 UTSW 2 85579402 missense possibly damaging 0.56
R7399:Olfr996 UTSW 2 85579296 missense probably benign 0.00
R8914:Olfr996 UTSW 2 85579712 missense possibly damaging 0.72
R9594:Olfr996 UTSW 2 85579538 nonsense probably null
R9686:Olfr996 UTSW 2 85579996 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCCATATGTAAGCCCTTGC -3'
(R):5'- TTCAAGGAGGAACTGACATTGG -3'

Sequencing Primer
(F):5'- GCCTTATGCCATTGCTCTTATAAG -3'
(R):5'- GACATTGGGTCTAACATAGATGAAG -3'
Posted On 2015-06-24