Incidental Mutation 'R4275:Olfr1089'
ID 324744
Institutional Source Beutler Lab
Gene Symbol Olfr1089
Ensembl Gene ENSMUSG00000111711
Gene Name olfactory receptor 1089
Synonyms MOR193-1, GA_x6K02T2Q125-48226321-48225386
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 86732584-86733701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86733592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 7 (T7A)
Ref Sequence ENSEMBL: ENSMUSP00000149509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214317]
AlphaFold A0A1L1SRK6
Predicted Effect probably damaging
Transcript: ENSMUST00000099876
AA Change: T7A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097461
Gene: ENSMUSG00000075173
AA Change: T7A

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.7e-47 PFAM
Pfam:7tm_1 41 290 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214317
AA Change: T7A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2460 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Olfr1089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1089 APN 2 86733235 missense possibly damaging 0.90
IGL00944:Olfr1089 APN 2 86733561 missense possibly damaging 0.80
IGL01478:Olfr1089 APN 2 86733329 nonsense probably null
IGL01636:Olfr1089 APN 2 86733601 nonsense probably null
IGL01887:Olfr1089 APN 2 86732686 missense probably benign 0.03
IGL02008:Olfr1089 APN 2 86733177 missense possibly damaging 0.90
IGL02470:Olfr1089 APN 2 86733585 missense probably damaging 0.97
IGL02560:Olfr1089 APN 2 86733234 missense probably damaging 1.00
R1782:Olfr1089 UTSW 2 86732682 missense probably benign 0.03
R2234:Olfr1089 UTSW 2 86733577 missense possibly damaging 0.94
R2866:Olfr1089 UTSW 2 86733429 missense possibly damaging 0.95
R3027:Olfr1089 UTSW 2 86733586 missense possibly damaging 0.79
R4799:Olfr1089 UTSW 2 86732674 splice site probably null
R5016:Olfr1089 UTSW 2 86732746 missense probably benign 0.17
R5154:Olfr1089 UTSW 2 86732777 nonsense probably null
R5355:Olfr1089 UTSW 2 86733336 missense probably damaging 1.00
R5624:Olfr1089 UTSW 2 86732805 missense probably benign 0.45
R6265:Olfr1089 UTSW 2 86732955 missense probably damaging 0.99
R7382:Olfr1089 UTSW 2 86732785 missense probably benign 0.02
R8009:Olfr1089 UTSW 2 86733504 missense probably damaging 0.99
R8850:Olfr1089 UTSW 2 86732958 missense probably damaging 0.99
R9652:Olfr1089 UTSW 2 86733292 missense probably damaging 1.00
X0028:Olfr1089 UTSW 2 86732748 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACAGCCAAGTGTTTGAG -3'
(R):5'- TCCAAGTTGAGCCATTGAACTATG -3'

Sequencing Primer
(F):5'- GAAAGAAGTACATGGGTGTTTGC -3'
(R):5'- TGAGCCATTGAACTATGTTTCATATC -3'
Posted On 2015-06-24