Incidental Mutation 'R4275:Nadk'
ID 324748
Institutional Source Beutler Lab
Gene Symbol Nadk
Ensembl Gene ENSMUSG00000029063
Gene Name NAD kinase
Synonyms
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 155562378-155591001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 155584255 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 128 (Y128N)
Ref Sequence ENSEMBL: ENSMUSP00000101238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030939] [ENSMUST00000105612] [ENSMUST00000105613] [ENSMUST00000135429] [ENSMUST00000146080]
AlphaFold P58058
Predicted Effect probably benign
Transcript: ENSMUST00000030939
AA Change: Y128N

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030939
Gene: ENSMUSG00000029063
AA Change: Y128N

DomainStartEndE-ValueType
Pfam:NAD_kinase 106 406 2.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105612
AA Change: Y52N

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101237
Gene: ENSMUSG00000029063
AA Change: Y52N

DomainStartEndE-ValueType
Pfam:NAD_kinase 30 330 7.6e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105613
AA Change: Y128N

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101238
Gene: ENSMUSG00000029063
AA Change: Y128N

DomainStartEndE-ValueType
Pfam:NAD_kinase 106 406 1.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135429
Predicted Effect probably benign
Transcript: ENSMUST00000146080
SMART Domains Protein: ENSMUSP00000117504
Gene: ENSMUSG00000029063

DomainStartEndE-ValueType
PDB:3PFN|D 68 85 8e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152297
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions (Lerner et al., 2001 [PubMed 11594753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Nadk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Nadk APN 4 155588700 splice site probably benign
IGL02078:Nadk APN 4 155579403 unclassified probably benign
IGL02116:Nadk APN 4 155579306 splice site probably benign
IGL02951:Nadk APN 4 155587476 missense probably benign 0.00
IGL03059:Nadk APN 4 155586796 missense probably benign 0.02
IGL03203:Nadk APN 4 155585251 missense probably damaging 0.99
R0416:Nadk UTSW 4 155587799 splice site probably benign
R1633:Nadk UTSW 4 155577185 missense probably damaging 1.00
R2044:Nadk UTSW 4 155585441 missense probably damaging 1.00
R2891:Nadk UTSW 4 155587360 missense possibly damaging 0.46
R2892:Nadk UTSW 4 155587360 missense possibly damaging 0.46
R2894:Nadk UTSW 4 155587360 missense possibly damaging 0.46
R4386:Nadk UTSW 4 155582575 unclassified probably benign
R4416:Nadk UTSW 4 155587726 nonsense probably null
R4703:Nadk UTSW 4 155585227 missense probably benign 0.00
R4704:Nadk UTSW 4 155585227 missense probably benign 0.00
R4705:Nadk UTSW 4 155585227 missense probably benign 0.00
R5219:Nadk UTSW 4 155584254 missense probably benign 0.00
R5610:Nadk UTSW 4 155584171 missense probably damaging 1.00
R5673:Nadk UTSW 4 155585185 missense possibly damaging 0.48
R6393:Nadk UTSW 4 155589351 missense possibly damaging 0.60
R7091:Nadk UTSW 4 155587758 missense probably benign 0.00
R7144:Nadk UTSW 4 155589336 missense probably damaging 0.99
R7811:Nadk UTSW 4 155576875 intron probably benign
R7951:Nadk UTSW 4 155577067 missense probably benign 0.06
R7952:Nadk UTSW 4 155577067 missense probably benign 0.06
R8002:Nadk UTSW 4 155577198 critical splice donor site probably null
R8039:Nadk UTSW 4 155577067 missense probably benign 0.06
R8041:Nadk UTSW 4 155577067 missense probably benign 0.06
R8042:Nadk UTSW 4 155577067 missense probably benign 0.06
R8066:Nadk UTSW 4 155577067 missense probably benign 0.06
R8113:Nadk UTSW 4 155570670 splice site probably null
R8558:Nadk UTSW 4 155585387 missense probably benign 0.40
R9122:Nadk UTSW 4 155586818 missense probably benign 0.00
Z1177:Nadk UTSW 4 155587700 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGGTGTACATATAGTTGGC -3'
(R):5'- CAGCACTACAGGCTGCTAAG -3'

Sequencing Primer
(F):5'- CATATAGTTGGCAATGTAGTTCTCC -3'
(R):5'- CTACAGGCTGCTAAGTATCTTTTAGG -3'
Posted On 2015-06-24