Incidental Mutation 'R4275:Fam131b'
ID324753
Institutional Source Beutler Lab
Gene Symbol Fam131b
Ensembl Gene ENSMUSG00000029861
Gene Namefamily with sequence similarity 131, member B
Synonyms6330503C03Rik, 6530406I18Rik
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4275 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42315312-42324643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42321307 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 43 (L43F)
Ref Sequence ENSEMBL: ENSMUSP00000093670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000095974] [ENSMUST00000143278]
Predicted Effect probably damaging
Transcript: ENSMUST00000031891
AA Change: L59F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861
AA Change: L59F

DomainStartEndE-ValueType
Pfam:FAM131 49 341 7.4e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095974
AA Change: L43F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861
AA Change: L43F

DomainStartEndE-ValueType
Pfam:FAM131 33 325 4.5e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143278
AA Change: L71F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861
AA Change: L71F

DomainStartEndE-ValueType
Pfam:FAM131 61 353 1.9e-113 PFAM
Meta Mutation Damage Score 0.1620 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Fam131b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Fam131b APN 6 42318961 missense probably damaging 1.00
IGL01328:Fam131b APN 6 42318272 missense probably damaging 1.00
IGL02948:Fam131b APN 6 42320992 splice site probably benign
IGL03226:Fam131b APN 6 42318954 missense possibly damaging 0.81
R0027:Fam131b UTSW 6 42318248 missense probably benign 0.01
R0027:Fam131b UTSW 6 42318248 missense probably benign 0.01
R1730:Fam131b UTSW 6 42318580 missense possibly damaging 0.75
R1783:Fam131b UTSW 6 42318580 missense possibly damaging 0.75
R1858:Fam131b UTSW 6 42318980 missense probably damaging 1.00
R1993:Fam131b UTSW 6 42320884 missense possibly damaging 0.94
R1994:Fam131b UTSW 6 42320884 missense possibly damaging 0.94
R4636:Fam131b UTSW 6 42320980 missense probably damaging 1.00
R5876:Fam131b UTSW 6 42321248 critical splice donor site probably null
R5877:Fam131b UTSW 6 42320979 missense probably benign 0.09
R5979:Fam131b UTSW 6 42321971 missense probably damaging 0.98
R7725:Fam131b UTSW 6 42318542 missense probably benign 0.01
Z1177:Fam131b UTSW 6 42318920 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCAGGATTGGAGAGGCTTGAC -3'
(R):5'- TATAGACAGGCTATTCTGCTGATCC -3'

Sequencing Primer
(F):5'- CTTGACATAAAACCAGGTGATTCGG -3'
(R):5'- TGATCCCCCAGTATGTACCAGG -3'
Posted On2015-06-24