Mutagenetix > Incidental Mutation

Incidental Mutation 'R4275:Igf2'

324756

Institutional Source

Beutler Lab

Gene Symbol

Igf2

Ensembl Gene

ENSMUSG00000048583

Gene Name

insulin-like growth factor 2

Synonyms

M6pr, Mpr, Igf-2, Igf-II, Peg2

MMRRC Submission

041646-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.518) question?

Stock #

R4275 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142650766-142666816 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142655786 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 46 (M46V)

Ref Sequence

ENSEMBL: ENSMUSP00000136786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000033] [ENSMUST00000097936] [ENSMUST00000105935] [ENSMUST00000105936] [ENSMUST00000121128] [ENSMUST00000145896] [ENSMUST00000178921] [ENSMUST00000228850]

AlphaFold

P09535

Predicted Effect

probably benign
Transcript: ENSMUST00000000033
AA Change: M9V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000000033
Gene: ENSMUSG00000048583
AA Change: M9V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IlGF	30	84	2.09e-22	SMART
Pfam:IGF2_C	112	166	3.2e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093631

Predicted Effect

probably benign
Transcript: ENSMUST00000097936
AA Change: M9V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095549
Gene: ENSMUSG00000048583
AA Change: M9V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IlGF	30	84	2.09e-22	SMART
Pfam:IGF2_C	112	166	3.2e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105935
AA Change: M9V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101555
Gene: ENSMUSG00000048583
AA Change: M9V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IlGF	30	84	2.09e-22	SMART
Pfam:IGF2_C	112	166	3.2e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105936
AA Change: M9V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101556
Gene: ENSMUSG00000048583
AA Change: M9V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IlGF	30	84	2.09e-22	SMART
Pfam:IGF2_C	112	166	3.2e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121128
AA Change: M20V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000114076
Gene: ENSMUSG00000048583
AA Change: M20V

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
IlGF	41	95	2.09e-22	SMART
Pfam:IGF2_C	123	177	6.9e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141551

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143666

Predicted Effect

probably benign
Transcript: ENSMUST00000145896
AA Change: M9V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000122653
Gene: ENSMUSG00000048583
AA Change: M9V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IlGF	30	84	2.09e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163148

Predicted Effect

probably benign
Transcript: ENSMUST00000178921
AA Change: M46V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000136786
Gene: ENSMUSG00000048583
AA Change: M46V

Domain	Start	End	E-Value	Type
IlGF	67	121	2.09e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000228850

Meta Mutation Damage Score

0.0712

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. It is an imprinted gene that is expressed only from the paternal allele. The encoded protein undergoes proteolytic processing to generate a mature peptide. The transgenic overexpression of this gene in mice results in prenatal overgrowth, polyhydramnios, fetal and neonatal lethality, disproportionate organ overgrowth including tongue enlargement, and skeletal abnormalities. Mice lacking the encoded protein exhibit growth deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mutations that are paternally transmitted result in growth deficiency. Heterozygous mice inheriting a mutant allele from their mother appear to be phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1e	T	C	1: 154,493,325	Y322C	probably damaging	Het
Camsap2	A	G	1: 136,270,876	V1462A	probably benign	Het
D3Ertd751e	C	A	3: 41,756,154		probably benign	Het
Dhcr7	C	T	7: 143,843,227	A152V	probably damaging	Het
Enpep	A	T	3: 129,332,278	N68K	probably benign	Het
Fam126b	T	C	1: 58,529,933	T440A	probably benign	Het
Fam131b	G	A	6: 42,321,307	L43F	probably damaging	Het
Fbxl5	T	A	5: 43,762,772		probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Kntc1	T	A	5: 123,767,779	Y367N	probably damaging	Het
Mapk8ip2	T	C	15: 89,458,995	W647R	probably damaging	Het
Mettl21c	C	T	1: 44,010,556	V110I	probably damaging	Het
Mrgprh	T	C	17: 12,877,227	L118P	probably damaging	Het
Myadm	A	G	7: 3,297,102	T127A	probably benign	Het
Myh10	A	T	11: 68,751,940		probably null	Het
Nadk	T	A	4: 155,584,255	Y128N	probably benign	Het
Olfr1089	T	C	2: 86,733,592	T7A	probably damaging	Het
Olfr996	T	C	2: 85,579,863	V208A	probably benign	Het
Papolg	A	G	11: 23,868,378	I500T	probably benign	Het
Pkhd1	A	T	1: 20,058,384	C4032S	probably benign	Het
Rnase1	A	T	14: 51,145,870	L9Q	probably damaging	Het
Rspry1	G	T	8: 94,649,761	V304L	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Scpep1	T	C	11: 88,947,142		probably null	Het
Serpina3m	T	A	12: 104,389,116	I14N	probably damaging	Het
Smg6	A	C	11: 74,993,874		probably benign	Het
Suz12	T	C	11: 80,030,053	M593T	probably damaging	Het
Tmem139	A	G	6: 42,264,105	E208G	probably damaging	Het
Tnxb	A	G	17: 34,698,231	Y2200C	probably damaging	Het
Usp19	T	G	9: 108,498,694	V911G	probably damaging	Het
Vipr1	T	C	9: 121,664,618	L245P	probably damaging	Het
Vmn2r105	T	A	17: 20,228,640	I92F	probably damaging	Het
Zfp518b	A	G	5: 38,671,728	V978A	probably damaging	Het
Zfp651	T	A	9: 121,766,539	V576D	probably damaging	Het

Other mutations in Igf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02458:Igf2	APN	7	142654048	missense	probably benign	0.09
R2012:Igf2	UTSW	7	142654399	missense	probably damaging	1.00
R4024:Igf2	UTSW	7	142654307	missense	probably benign	0.23
R5247:Igf2	UTSW	7	142653931	missense	possibly damaging	0.90
R5825:Igf2	UTSW	7	142653855	missense	probably damaging	0.97
R6185:Igf2	UTSW	7	142658381	missense	possibly damaging	0.95
R7286:Igf2	UTSW	7	142655818	missense	possibly damaging	0.71
R8501:Igf2	UTSW	7	142654042	missense	probably damaging	0.98
R9048:Igf2	UTSW	7	142654022	missense	probably benign	0.01
R9303:Igf2	UTSW	7	142654416	missense	probably damaging	1.00
R9304:Igf2	UTSW	7	142654416	missense	probably damaging	1.00
R9305:Igf2	UTSW	7	142654416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAATTGTCACCCCATCCAGG -3'
(R):5'- TGACCTCAGCAATTCAAGTCC -3'

Sequencing Primer
(F):5'- ATCCAGGGAGGCTTGCTTC -3'
(R):5'- TCAGCAATTCAAGTCCCCCTG -3'

Posted On

2015-06-24