Incidental Mutation 'R4275:Vipr1'
ID324760
Institutional Source Beutler Lab
Gene Symbol Vipr1
Ensembl Gene ENSMUSG00000032528
Gene Namevasoactive intestinal peptide receptor 1
SynonymsVPAC1, VIP-R1, VIP receptor subtype 1
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4275 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121642716-121672954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121664618 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 245 (L245P)
Ref Sequence ENSEMBL: ENSMUSP00000035115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035115]
Predicted Effect probably damaging
Transcript: ENSMUST00000035115
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035115
Gene: ENSMUSG00000032528
AA Change: L245P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
HormR 59 131 7.38e-26 SMART
Pfam:7tm_2 140 386 1.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149959
Meta Mutation Damage Score 0.7618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with severe neonatal growth failure, enlarged cecum, intestinal hemorrhage, and enterocyte hyperproliferation in addition to disorganized islets and impaired glucose homeostasisin surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Vipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Vipr1 APN 9 121665178 missense probably damaging 0.99
IGL01779:Vipr1 APN 9 121664630 missense probably damaging 1.00
IGL01809:Vipr1 APN 9 121661440 missense possibly damaging 0.70
IGL02250:Vipr1 APN 9 121665189 missense probably benign 0.10
IGL02677:Vipr1 APN 9 121660283 splice site probably benign
bernalillo UTSW 9 121664618 missense probably damaging 1.00
R0036:Vipr1 UTSW 9 121660983 missense probably benign
R0514:Vipr1 UTSW 9 121658049 missense probably damaging 1.00
R0629:Vipr1 UTSW 9 121660171 nonsense probably null
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1766:Vipr1 UTSW 9 121661419 missense possibly damaging 0.87
R1884:Vipr1 UTSW 9 121665864 missense possibly damaging 0.56
R1945:Vipr1 UTSW 9 121668474 missense probably damaging 1.00
R1945:Vipr1 UTSW 9 121668475 missense probably damaging 1.00
R2366:Vipr1 UTSW 9 121665184 missense probably benign 0.19
R4600:Vipr1 UTSW 9 121665136 splice site probably null
R5012:Vipr1 UTSW 9 121658045 critical splice acceptor site probably null
R6190:Vipr1 UTSW 9 121664653 missense probably damaging 1.00
R6376:Vipr1 UTSW 9 121664574 missense probably damaging 1.00
R6473:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R6476:Vipr1 UTSW 9 121669423 missense probably benign 0.28
R6641:Vipr1 UTSW 9 121669565 makesense probably null
R6752:Vipr1 UTSW 9 121653893 missense probably damaging 0.99
R7189:Vipr1 UTSW 9 121664554 missense probably damaging 0.97
R7371:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R7419:Vipr1 UTSW 9 121661473 missense probably damaging 0.97
R7647:Vipr1 UTSW 9 121653839 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GTTTGAAAAGCCTGGCTGC -3'
(R):5'- ACGCATTCTGGGGACATTCATG -3'

Sequencing Primer
(F):5'- TGACAGCATCCAAGTTGGCTG -3'
(R):5'- CATTCATGAATGTCGGTGGAGAACC -3'
Posted On2015-06-24