Mutagenetix > Incidental Mutation

Incidental Mutation 'R4275:Vipr1'

324760

Institutional Source

Beutler Lab

Gene Symbol

Vipr1

Ensembl Gene

ENSMUSG00000032528

Gene Name

vasoactive intestinal peptide receptor 1

Synonyms

VPAC1, VIP-R1, VIP receptor subtype 1

MMRRC Submission

041646-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4275 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121642716-121672954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121664618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 245 (L245P)

Ref Sequence

ENSEMBL: ENSMUSP00000035115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035115]

AlphaFold

P97751

Predicted Effect

probably damaging
Transcript: ENSMUST00000035115
AA Change: L245P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035115
Gene: ENSMUSG00000032528
AA Change: L245P

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
HormR	59	131	7.38e-26	SMART
Pfam:7tm_2	140	386	1.4e-95	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129394

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149959

Meta Mutation Damage Score

0.7618

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with severe neonatal growth failure, enlarged cecum, intestinal hemorrhage, and enterocyte hyperproliferation in addition to disorganized islets and impaired glucose homeostasisin surviving mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1e	T	C	1: 154,493,325	Y322C	probably damaging	Het
Camsap2	A	G	1: 136,270,876	V1462A	probably benign	Het
D3Ertd751e	C	A	3: 41,756,154		probably benign	Het
Dhcr7	C	T	7: 143,843,227	A152V	probably damaging	Het
Enpep	A	T	3: 129,332,278	N68K	probably benign	Het
Fam126b	T	C	1: 58,529,933	T440A	probably benign	Het
Fam131b	G	A	6: 42,321,307	L43F	probably damaging	Het
Fbxl5	T	A	5: 43,762,772		probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Igf2	T	C	7: 142,655,786	M46V	probably benign	Het
Kntc1	T	A	5: 123,767,779	Y367N	probably damaging	Het
Mapk8ip2	T	C	15: 89,458,995	W647R	probably damaging	Het
Mettl21c	C	T	1: 44,010,556	V110I	probably damaging	Het
Mrgprh	T	C	17: 12,877,227	L118P	probably damaging	Het
Myadm	A	G	7: 3,297,102	T127A	probably benign	Het
Myh10	A	T	11: 68,751,940		probably null	Het
Nadk	T	A	4: 155,584,255	Y128N	probably benign	Het
Olfr1089	T	C	2: 86,733,592	T7A	probably damaging	Het
Olfr996	T	C	2: 85,579,863	V208A	probably benign	Het
Papolg	A	G	11: 23,868,378	I500T	probably benign	Het
Pkhd1	A	T	1: 20,058,384	C4032S	probably benign	Het
Rnase1	A	T	14: 51,145,870	L9Q	probably damaging	Het
Rspry1	G	T	8: 94,649,761	V304L	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Scpep1	T	C	11: 88,947,142		probably null	Het
Serpina3m	T	A	12: 104,389,116	I14N	probably damaging	Het
Smg6	A	C	11: 74,993,874		probably benign	Het
Suz12	T	C	11: 80,030,053	M593T	probably damaging	Het
Tmem139	A	G	6: 42,264,105	E208G	probably damaging	Het
Tnxb	A	G	17: 34,698,231	Y2200C	probably damaging	Het
Usp19	T	G	9: 108,498,694	V911G	probably damaging	Het
Vmn2r105	T	A	17: 20,228,640	I92F	probably damaging	Het
Zfp518b	A	G	5: 38,671,728	V978A	probably damaging	Het
Zfp651	T	A	9: 121,766,539	V576D	probably damaging	Het

Other mutations in Vipr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01456:Vipr1	APN	9	121665178	missense	probably damaging	0.99
IGL01779:Vipr1	APN	9	121664630	missense	probably damaging	1.00
IGL01809:Vipr1	APN	9	121661440	missense	possibly damaging	0.70
IGL02250:Vipr1	APN	9	121665189	missense	probably benign	0.10
IGL02677:Vipr1	APN	9	121660283	splice site	probably benign
bernalillo	UTSW	9	121664618	missense	probably damaging	1.00
R0036:Vipr1	UTSW	9	121660983	missense	probably benign
R0514:Vipr1	UTSW	9	121658049	missense	probably damaging	1.00
R0629:Vipr1	UTSW	9	121660171	nonsense	probably null
R1470:Vipr1	UTSW	9	121665520	missense	possibly damaging	0.66
R1470:Vipr1	UTSW	9	121665520	missense	possibly damaging	0.66
R1766:Vipr1	UTSW	9	121661419	missense	possibly damaging	0.87
R1884:Vipr1	UTSW	9	121665864	missense	possibly damaging	0.56
R1945:Vipr1	UTSW	9	121668474	missense	probably damaging	1.00
R1945:Vipr1	UTSW	9	121668475	missense	probably damaging	1.00
R2366:Vipr1	UTSW	9	121665184	missense	probably benign	0.19
R4600:Vipr1	UTSW	9	121665136	splice site	probably null
R5012:Vipr1	UTSW	9	121658045	critical splice acceptor site	probably null
R6190:Vipr1	UTSW	9	121664653	missense	probably damaging	1.00
R6376:Vipr1	UTSW	9	121664574	missense	probably damaging	1.00
R6473:Vipr1	UTSW	9	121668555	missense	probably damaging	1.00
R6476:Vipr1	UTSW	9	121669423	missense	probably benign	0.28
R6641:Vipr1	UTSW	9	121669565	makesense	probably null
R6752:Vipr1	UTSW	9	121653893	missense	probably damaging	0.99
R7189:Vipr1	UTSW	9	121664554	missense	probably damaging	0.97
R7371:Vipr1	UTSW	9	121668555	missense	probably damaging	1.00
R7419:Vipr1	UTSW	9	121661473	missense	probably damaging	0.97
R7647:Vipr1	UTSW	9	121653839	missense	possibly damaging	0.79
R8123:Vipr1	UTSW	9	121669452	missense	probably damaging	1.00
R8225:Vipr1	UTSW	9	121642849	start codon destroyed	possibly damaging	0.59
R8675:Vipr1	UTSW	9	121664666	missense	probably damaging	1.00
R9256:Vipr1	UTSW	9	121661052	missense	probably benign	0.09
R9343:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9344:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9422:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9424:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9463:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9464:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9517:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9576:Vipr1	UTSW	9	121642927	critical splice donor site	probably null
R9577:Vipr1	UTSW	9	121642927	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTGAAAAGCCTGGCTGC -3'
(R):5'- ACGCATTCTGGGGACATTCATG -3'

Sequencing Primer
(F):5'- TGACAGCATCCAAGTTGGCTG -3'
(R):5'- CATTCATGAATGTCGGTGGAGAACC -3'

Posted On

2015-06-24