Incidental Mutation 'R4275:Zfp651'
ID 324761
Institutional Source Beutler Lab
Gene Symbol Zfp651
Ensembl Gene ENSMUSG00000013419
Gene Name zinc finger protein 651
Synonyms 4732420M22Rik
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 121759330-121771742 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121766539 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 576 (V576D)
Ref Sequence ENSEMBL: ENSMUSP00000091286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093772]
AlphaFold E9PZ11
Predicted Effect probably damaging
Transcript: ENSMUST00000093772
AA Change: V576D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091286
Gene: ENSMUSG00000013419
AA Change: V576D

DomainStartEndE-ValueType
BTB 45 141 3.69e-19 SMART
low complexity region 159 164 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 217 231 N/A INTRINSIC
low complexity region 302 339 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
ZnF_C2H2 447 470 1.28e-3 SMART
ZnF_C2H2 474 494 8.4e1 SMART
ZnF_C2H2 501 524 1.76e-1 SMART
ZnF_C2H2 531 553 3.34e-2 SMART
ZnF_C2H2 559 581 6.78e-3 SMART
ZnF_C2H2 587 609 3.63e-3 SMART
ZnF_C2H2 615 637 1.95e-3 SMART
ZnF_C2H2 643 665 6.62e-6 SMART
ZnF_C2H2 671 698 4.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213743
Predicted Effect probably benign
Transcript: ENSMUST00000214732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215081
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Other mutations in Zfp651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Zfp651 APN 9 121763969 missense probably damaging 1.00
R0193:Zfp651 UTSW 9 121767666 missense probably damaging 0.98
R0270:Zfp651 UTSW 9 121767575 missense probably benign 0.27
R0347:Zfp651 UTSW 9 121763102 missense probably damaging 1.00
R0654:Zfp651 UTSW 9 121763261 missense probably benign 0.01
R2202:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2203:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2204:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2205:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2364:Zfp651 UTSW 9 121767594 missense probably damaging 0.98
R3843:Zfp651 UTSW 9 121763433 missense possibly damaging 0.86
R4934:Zfp651 UTSW 9 121763979 missense probably damaging 0.99
R5358:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R5462:Zfp651 UTSW 9 121767663 missense probably damaging 0.99
R5613:Zfp651 UTSW 9 121767519 missense probably damaging 1.00
R5843:Zfp651 UTSW 9 121767339 missense possibly damaging 0.47
R5863:Zfp651 UTSW 9 121767530 missense probably benign 0.22
R6009:Zfp651 UTSW 9 121762871 missense possibly damaging 0.86
R6063:Zfp651 UTSW 9 121763532 missense probably benign 0.01
R6114:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R6223:Zfp651 UTSW 9 121763787 missense possibly damaging 0.61
R6414:Zfp651 UTSW 9 121763659 missense probably benign
R6811:Zfp651 UTSW 9 121766529 missense probably damaging 1.00
R7394:Zfp651 UTSW 9 121767345 missense probably damaging 0.98
R7430:Zfp651 UTSW 9 121763666 missense probably benign 0.02
R8215:Zfp651 UTSW 9 121767278 missense probably benign 0.40
R8900:Zfp651 UTSW 9 121767639 missense probably damaging 0.99
R8982:Zfp651 UTSW 9 121763268 missense probably benign 0.26
R9623:Zfp651 UTSW 9 121762924 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAGAAAAGCGTGGGGTGC -3'
(R):5'- AGGCCTGCAAAGAAACATTTCC -3'

Sequencing Primer
(F):5'- CCTGAAGAAGTGACGTCT -3'
(R):5'- GAATAGAAGCCCTGCTCCTCCTG -3'
Posted On 2015-06-24