Mutagenetix > Incidental Mutation

Incidental Mutation 'R4275:Smg6'

324765

Institutional Source

Beutler Lab

Gene Symbol

Smg6

Ensembl Gene

ENSMUSG00000038290

Gene Name

Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)

Synonyms

MMRRC Submission

041646-MU

Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4275 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74925823-75164448 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to C at 74993874 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000140197]

AlphaFold

P61406

Predicted Effect

probably benign
Transcript: ENSMUST00000045281

SMART Domains

Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

Domain	Start	End	E-Value	Type
internal_repeat_1	42	99	7.68e-6	PROSPERO
internal_repeat_1	135	188	7.68e-6	PROSPERO
low complexity region	212	227	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	376	390	N/A	INTRINSIC
low complexity region	417	426	N/A	INTRINSIC
low complexity region	436	453	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
coiled coil region	574	600	N/A	INTRINSIC
Pfam:EST1	637	742	1.8e-18	PFAM
Pfam:EST1_DNA_bind	750	1106	1.6e-78	PFAM
coiled coil region	1197	1234	N/A	INTRINSIC
PINc	1245	1396	2.85e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130145

SMART Domains

Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
Pfam:EST1	99	204	1.3e-19	PFAM
Pfam:EST1_DNA_bind	212	339	7.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135522

Predicted Effect

unknown
Transcript: ENSMUST00000140197
AA Change: I8L

SMART Domains

Protein: ENSMUSP00000120060
Gene: ENSMUSG00000038290
AA Change: I8L

Domain	Start	End	E-Value	Type
Pfam:EST1_DNA_bind	2	167	4.9e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189608

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]

Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1e	T	C	1: 154,493,325	Y322C	probably damaging	Het
Camsap2	A	G	1: 136,270,876	V1462A	probably benign	Het
D3Ertd751e	C	A	3: 41,756,154		probably benign	Het
Dhcr7	C	T	7: 143,843,227	A152V	probably damaging	Het
Enpep	A	T	3: 129,332,278	N68K	probably benign	Het
Fam126b	T	C	1: 58,529,933	T440A	probably benign	Het
Fam131b	G	A	6: 42,321,307	L43F	probably damaging	Het
Fbxl5	T	A	5: 43,762,772		probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Igf2	T	C	7: 142,655,786	M46V	probably benign	Het
Kntc1	T	A	5: 123,767,779	Y367N	probably damaging	Het
Mapk8ip2	T	C	15: 89,458,995	W647R	probably damaging	Het
Mettl21c	C	T	1: 44,010,556	V110I	probably damaging	Het
Mrgprh	T	C	17: 12,877,227	L118P	probably damaging	Het
Myadm	A	G	7: 3,297,102	T127A	probably benign	Het
Myh10	A	T	11: 68,751,940		probably null	Het
Nadk	T	A	4: 155,584,255	Y128N	probably benign	Het
Olfr1089	T	C	2: 86,733,592	T7A	probably damaging	Het
Olfr996	T	C	2: 85,579,863	V208A	probably benign	Het
Papolg	A	G	11: 23,868,378	I500T	probably benign	Het
Pkhd1	A	T	1: 20,058,384	C4032S	probably benign	Het
Rnase1	A	T	14: 51,145,870	L9Q	probably damaging	Het
Rspry1	G	T	8: 94,649,761	V304L	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Scpep1	T	C	11: 88,947,142		probably null	Het
Serpina3m	T	A	12: 104,389,116	I14N	probably damaging	Het
Suz12	T	C	11: 80,030,053	M593T	probably damaging	Het
Tmem139	A	G	6: 42,264,105	E208G	probably damaging	Het
Tnxb	A	G	17: 34,698,231	Y2200C	probably damaging	Het
Usp19	T	G	9: 108,498,694	V911G	probably damaging	Het
Vipr1	T	C	9: 121,664,618	L245P	probably damaging	Het
Vmn2r105	T	A	17: 20,228,640	I92F	probably damaging	Het
Zfp518b	A	G	5: 38,671,728	V978A	probably damaging	Het
Zfp651	T	A	9: 121,766,539	V576D	probably damaging	Het

Other mutations in Smg6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Smg6	APN	11	74929148	missense	probably benign
IGL01146:Smg6	APN	11	74930428	nonsense	probably null
IGL01505:Smg6	APN	11	75156291	missense	probably damaging	1.00
IGL01541:Smg6	APN	11	74925944	missense	probably benign	0.43
IGL01636:Smg6	APN	11	74935103	critical splice donor site	probably null
IGL02379:Smg6	APN	11	75053925	missense	probably damaging	1.00
IGL02794:Smg6	APN	11	75053934	missense	probably damaging	0.99
IGL02964:Smg6	APN	11	74930750	critical splice donor site	probably null
IGL03057:Smg6	APN	11	74935434	nonsense	probably null
1mM(1):Smg6	UTSW	11	74934989	splice site	probably benign
IGL03097:Smg6	UTSW	11	74932426	missense	probably damaging	1.00
PIT4802001:Smg6	UTSW	11	75156165	missense	probably damaging	0.96
R0269:Smg6	UTSW	11	75162931	missense	probably benign
R0344:Smg6	UTSW	11	74929821	missense	probably damaging	1.00
R0437:Smg6	UTSW	11	74929701	missense	probably damaging	1.00
R0452:Smg6	UTSW	11	74930213	missense	probably benign
R0511:Smg6	UTSW	11	74929058	missense	probably damaging	1.00
R0617:Smg6	UTSW	11	75162931	missense	probably benign
R0737:Smg6	UTSW	11	75159836	missense	probably damaging	1.00
R1715:Smg6	UTSW	11	74929430	missense	probably benign
R1780:Smg6	UTSW	11	74946116	missense	probably damaging	1.00
R1927:Smg6	UTSW	11	75142848	missense	probably damaging	1.00
R2073:Smg6	UTSW	11	74930294	missense	probably damaging	1.00
R2171:Smg6	UTSW	11	75038646	missense	probably damaging	1.00
R2513:Smg6	UTSW	11	74929676	missense	probably damaging	1.00
R3943:Smg6	UTSW	11	74929541	missense	probably damaging	1.00
R3944:Smg6	UTSW	11	74929541	missense	probably damaging	1.00
R4369:Smg6	UTSW	11	74932443	nonsense	probably null
R4452:Smg6	UTSW	11	74990141	missense	probably benign	0.14
R4864:Smg6	UTSW	11	74930162	missense	possibly damaging	0.89
R4885:Smg6	UTSW	11	75041918	missense	probably damaging	1.00
R5043:Smg6	UTSW	11	74929895	missense	possibly damaging	0.86
R5189:Smg6	UTSW	11	75041996	missense	probably damaging	1.00
R5378:Smg6	UTSW	11	75041994	missense	possibly damaging	0.61
R5518:Smg6	UTSW	11	75053898	missense	probably damaging	0.99
R5725:Smg6	UTSW	11	74930613	missense	probably benign	0.45
R5746:Smg6	UTSW	11	75139287	missense	probably damaging	1.00
R6151:Smg6	UTSW	11	75156207	missense	probably damaging	0.96
R6319:Smg6	UTSW	11	75156222	missense	probably damaging	1.00
R6349:Smg6	UTSW	11	75053774	missense	possibly damaging	0.94
R6500:Smg6	UTSW	11	74930505	missense	possibly damaging	0.74
R6619:Smg6	UTSW	11	74932453	critical splice donor site	probably null
R6820:Smg6	UTSW	11	75041964	missense	probably damaging	0.99
R6923:Smg6	UTSW	11	74929343	missense	possibly damaging	0.50
R7361:Smg6	UTSW	11	74930153	missense	probably benign	0.00
R7494:Smg6	UTSW	11	74929623	missense	probably benign
R7498:Smg6	UTSW	11	74929106	missense	probably benign	0.01
R7681:Smg6	UTSW	11	74931705	missense	probably damaging	1.00
R7710:Smg6	UTSW	11	74930619	missense	probably benign	0.26
R7770:Smg6	UTSW	11	74993861	missense	unknown
R8159:Smg6	UTSW	11	75038639	missense	probably damaging	1.00
R8381:Smg6	UTSW	11	74931740	missense	probably damaging	1.00
R8463:Smg6	UTSW	11	74930060	missense	probably benign	0.14
R8509:Smg6	UTSW	11	75041876	missense	probably benign	0.04
R8557:Smg6	UTSW	11	75156238	missense	probably damaging	0.98
R8743:Smg6	UTSW	11	74930033	missense	probably benign
R9240:Smg6	UTSW	11	74935058	missense	probably damaging	1.00
R9312:Smg6	UTSW	11	74930051	missense	probably benign	0.27
X0018:Smg6	UTSW	11	74929986	missense	possibly damaging	0.76
Z1186:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1187:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1188:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1189:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1190:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1191:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1192:Smg6	UTSW	11	75156266	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGGCTGGTATTCATTAGACACAG -3'
(R):5'- GGGGATGCAAAGAGGTTTCC -3'

Sequencing Primer
(F):5'- GCATGTATGTTGAATGCAAGAAGTTG -3'
(R):5'- CTTGTCCTCGAGAAACTAGT -3'

Posted On

2015-06-24