Incidental Mutation 'R4275:Suz12'
ID324766
Institutional Source Beutler Lab
Gene Symbol Suz12
Ensembl Gene ENSMUSG00000017548
Gene NameSUZ12 polycomb repressive complex 2 subunit
Synonyms2610028O16Rik, D11Ertd530e
MMRRC Submission 041646-MU
Accession Numbers

Genbank: NM_199196, NM_001163018; MGI: 1261758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4275 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79993106-80034123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80030053 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 593 (M593T)
Ref Sequence ENSEMBL: ENSMUSP00000126932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017692] [ENSMUST00000144188] [ENSMUST00000163272]
Predicted Effect probably damaging
Transcript: ENSMUST00000017692
AA Change: M616T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017692
Gene: ENSMUSG00000017548
AA Change: M616T

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 5e-3 SMART
ZnF_C2H2 450 473 4.45e0 SMART
Pfam:VEFS-Box 548 682 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144188
SMART Domains Protein: ENSMUSP00000128945
Gene: ENSMUSG00000017548

DomainStartEndE-ValueType
ZnF_C2H2 8 31 4.45e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163272
AA Change: M593T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126932
Gene: ENSMUSG00000017548
AA Change: M593T

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 6e-3 SMART
ZnF_C2H2 427 450 4.45e0 SMART
Pfam:VEFS-Box 523 660 2.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181152
Meta Mutation Damage Score 0.9629 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a core component of the polycomb repressive complex 2 (PRC2) that also includes, at least, embryonic ectoderm development protein (EED) and enhancer of zeste homolog 1 or 2 (EZH1 or EZH2). Through the methyltransferase activity of EZH1 or EZH2, the PRC2 complex methylates Lys9 and Lys27 of histone 3 and Lys26 of histone 1, leading to recruitment of the PRC1 complex, histone 2A ubiquitylation and transcriptional repression of the target genes. This gene product is essential for the activity and integrity of the PRC2 complex, and is required for X chromosome inactivation, stem cell maintenance and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice die during early postimplantation stages with failure of embryonic and extraembyronic tissues and organogenesis. Mice heterozygous for a knock-out allele exhibit abnormal brain and spinal cord development with varying penetrance. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(30) Chemically induced(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Suz12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Suz12 APN 11 79999092 missense probably damaging 0.99
IGL00938:Suz12 APN 11 80007569 splice site probably benign
IGL01902:Suz12 APN 11 80025950 missense probably benign 0.04
IGL02998:Suz12 APN 11 80029323 missense probably damaging 1.00
3-1:Suz12 UTSW 11 79999049 intron probably benign
R0317:Suz12 UTSW 11 79999078 missense probably damaging 1.00
R0453:Suz12 UTSW 11 80030033 missense probably damaging 1.00
R1454:Suz12 UTSW 11 80032113 missense probably benign
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1745:Suz12 UTSW 11 80022096 missense probably damaging 0.99
R1868:Suz12 UTSW 11 80013599 splice site probably null
R1957:Suz12 UTSW 11 79999100 missense probably benign 0.01
R2192:Suz12 UTSW 11 80022198 missense probably damaging 1.00
R3003:Suz12 UTSW 11 80019761 missense probably damaging 1.00
R3758:Suz12 UTSW 11 80024942 missense probably benign 0.00
R4017:Suz12 UTSW 11 80013466 missense probably damaging 1.00
R4366:Suz12 UTSW 11 80002162 intron probably benign
R4487:Suz12 UTSW 11 80032113 missense probably benign
R4663:Suz12 UTSW 11 80013524 missense probably damaging 1.00
R4730:Suz12 UTSW 11 80002162 intron probably benign
R4959:Suz12 UTSW 11 80029231 missense probably damaging 1.00
R5763:Suz12 UTSW 11 80025308 nonsense probably null
R6238:Suz12 UTSW 11 80002180 intron probably benign
R6379:Suz12 UTSW 11 80015188 missense possibly damaging 0.87
R6880:Suz12 UTSW 11 80002172 nonsense probably null
R7122:Suz12 UTSW 11 79993593 missense probably damaging 0.99
R7195:Suz12 UTSW 11 80013483 missense probably damaging 1.00
R7343:Suz12 UTSW 11 80019703 missense probably benign 0.34
R7472:Suz12 UTSW 11 80024975 missense probably benign 0.01
X0023:Suz12 UTSW 11 80029240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTTTCCTTAAGTGAAAGTTGGTT -3'
(R):5'- TTTTAGCATTGAGGCAAAAGGGAGT -3'

Sequencing Primer
(F):5'- CAGTGCTGTGTAGAGAGACCCTG -3'
(R):5'- TTGTAGAAATCCTGGGTAGCACC -3'
Posted On2015-06-24