Incidental Mutation 'R4275:Scpep1'
ID 324767
Institutional Source Beutler Lab
Gene Symbol Scpep1
Ensembl Gene ENSMUSG00000000278
Gene Name serine carboxypeptidase 1
Synonyms 4833411K15Rik, 2410018F01Rik, Risc
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 88924020-88955465 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 88947142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000287]
AlphaFold Q920A5
Predicted Effect probably null
Transcript: ENSMUST00000000287
SMART Domains Protein: ENSMUSP00000000287
Gene: ENSMUSG00000000278

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Peptidase_S10 29 451 2e-99 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit no abnormal phenotype. Mice homozygous for a knock-out allele exhibit abnormal blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Scpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Scpep1 APN 11 88952477 missense probably damaging 1.00
IGL01123:Scpep1 APN 11 88941328 missense possibly damaging 0.79
IGL02341:Scpep1 APN 11 88944488 missense probably benign 0.30
IGL03078:Scpep1 APN 11 88935831 missense possibly damaging 0.67
IGL03014:Scpep1 UTSW 11 88933445 splice site probably null
R1652:Scpep1 UTSW 11 88952434 nonsense probably null
R1966:Scpep1 UTSW 11 88952414 missense probably damaging 1.00
R4330:Scpep1 UTSW 11 88935903 nonsense probably null
R4331:Scpep1 UTSW 11 88935903 nonsense probably null
R4360:Scpep1 UTSW 11 88930244 missense possibly damaging 0.78
R4502:Scpep1 UTSW 11 88944385 missense probably benign 0.00
R4885:Scpep1 UTSW 11 88935911 missense probably benign 0.20
R4896:Scpep1 UTSW 11 88941296 missense probably damaging 1.00
R5010:Scpep1 UTSW 11 88941349 missense probably benign 0.30
R5229:Scpep1 UTSW 11 88937045 missense probably damaging 1.00
R5899:Scpep1 UTSW 11 88934576 critical splice donor site probably null
R5999:Scpep1 UTSW 11 88929313 missense possibly damaging 0.85
R6975:Scpep1 UTSW 11 88947205 missense probably damaging 0.98
R7098:Scpep1 UTSW 11 88929185 missense possibly damaging 0.59
R7637:Scpep1 UTSW 11 88929220 missense probably damaging 1.00
R7790:Scpep1 UTSW 11 88933521 missense possibly damaging 0.70
R8285:Scpep1 UTSW 11 88952467 missense probably damaging 1.00
R8750:Scpep1 UTSW 11 88944472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGACAGGGGACAAGC -3'
(R):5'- AGCTGCAAGTGTGTCCTTC -3'

Sequencing Primer
(F):5'- AAGCTCCGCTGCAGCAAG -3'
(R):5'- CTGCAAGTGTGTCCTTCGTATG -3'
Posted On 2015-06-24