Incidental Mutation 'R4275:Serpina3m'
ID 324768
Institutional Source Beutler Lab
Gene Symbol Serpina3m
Ensembl Gene ENSMUSG00000079012
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3M
Synonyms antitrypsin, Spi2.4, alpha-1 antiproteinase, MMSPi2.4, contrapsin-like, Spi-2l, Spi-2rs1, 3e46, MMCM7, Spi2-rs1
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 104338486-104394257 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104389116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 14 (I14N)
Ref Sequence ENSEMBL: ENSMUSP00000130979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101078] [ENSMUST00000168797]
AlphaFold Q03734
Predicted Effect probably damaging
Transcript: ENSMUST00000101078
AA Change: I14N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098639
Gene: ENSMUSG00000079012
AA Change: I14N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168797
AA Change: I14N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130979
Gene: ENSMUSG00000079012
AA Change: I14N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Serpina3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4976:Serpina3m UTSW 12 104358623 splice site probably null
R1797:Serpina3m UTSW 12 104389515 missense probably damaging 1.00
R1929:Serpina3m UTSW 12 104389322 missense probably damaging 0.97
R1991:Serpina3m UTSW 12 104389699 nonsense probably null
R2032:Serpina3m UTSW 12 104389669 missense probably benign 0.00
R2094:Serpina3m UTSW 12 104389270 missense probably benign 0.35
R2103:Serpina3m UTSW 12 104389699 nonsense probably null
R2121:Serpina3m UTSW 12 104389682 missense possibly damaging 0.59
R2147:Serpina3m UTSW 12 104389224 missense probably benign 0.01
R2241:Serpina3m UTSW 12 104389449 missense probably benign 0.01
R2330:Serpina3m UTSW 12 104391704 missense possibly damaging 0.61
R4057:Serpina3m UTSW 12 104391737 splice site probably benign
R4466:Serpina3m UTSW 12 104391615 missense probably damaging 1.00
R4901:Serpina3m UTSW 12 104389649 nonsense probably null
R4924:Serpina3m UTSW 12 104391470 missense probably benign 0.00
R4964:Serpina3m UTSW 12 104389101 missense probably benign 0.43
R5723:Serpina3m UTSW 12 104393911 missense probably damaging 0.96
R5836:Serpina3m UTSW 12 104389250 missense probably damaging 1.00
R6172:Serpina3m UTSW 12 104389227 missense probably damaging 1.00
R6619:Serpina3m UTSW 12 104391507 missense probably benign 0.02
R6857:Serpina3m UTSW 12 104389326 missense probably damaging 1.00
R6886:Serpina3m UTSW 12 104389127 missense possibly damaging 0.94
R7063:Serpina3m UTSW 12 104391467 missense probably benign 0.00
R7170:Serpina3m UTSW 12 104389518 missense probably damaging 1.00
R7622:Serpina3m UTSW 12 104389575 missense possibly damaging 0.82
R8222:Serpina3m UTSW 12 104392701 missense possibly damaging 0.78
R8771:Serpina3m UTSW 12 104391582 missense probably damaging 0.98
R8853:Serpina3m UTSW 12 104389655 missense probably benign
R8913:Serpina3m UTSW 12 104389218 missense probably benign 0.32
R9641:Serpina3m UTSW 12 104393826 nonsense probably null
R9709:Serpina3m UTSW 12 104392749 missense probably damaging 1.00
Z1177:Serpina3m UTSW 12 104389452 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGTACTGAATCTGAGAGGCC -3'
(R):5'- CAGCTGAGATGCTAAGTGGG -3'

Sequencing Primer
(F):5'- CCTCCTGTGGACAGTCAAAGAG -3'
(R):5'- GGGGAGAAGACAATATTTTTATCTGG -3'
Posted On 2015-06-24