Incidental Mutation 'R4275:Rnase1'
ID 324770
Institutional Source Beutler Lab
Gene Symbol Rnase1
Ensembl Gene ENSMUSG00000035896
Gene Name ribonuclease, RNase A family, 1 (pancreatic)
Synonyms Rib1, Rib-1
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 51144998-51146785 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51145870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 9 (L9Q)
Ref Sequence ENSEMBL: ENSMUSP00000079025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080126]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080126
AA Change: L9Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079025
Gene: ENSMUSG00000035896
AA Change: L9Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
RNAse_Pc 26 149 4.35e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226251
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pancreatic-type of secretory ribonucleases, a subset of the ribonuclease A superfamily. The encoded endonuclease cleaves internal phosphodiester RNA bonds on the 3'-side of pyrimidine bases. It prefers poly(C) as a substrate and hydrolyzes 2',3'-cyclic nucleotides, with a pH optimum near 8.0. The encoded protein is monomeric and more commonly acts to degrade ds-RNA over ss-RNA. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Rnase1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Rnase1 APN 14 51145546 missense probably benign 0.02
IGL01103:Rnase1 APN 14 51145622 missense probably benign 0.01
IGL01859:Rnase1 APN 14 51145803 missense probably benign 0.00
R2424:Rnase1 UTSW 14 51145547 missense possibly damaging 0.56
R5579:Rnase1 UTSW 14 51145762 missense probably benign
R5807:Rnase1 UTSW 14 51145450 missense probably benign 0.31
R9090:Rnase1 UTSW 14 51145507 missense possibly damaging 0.63
R9271:Rnase1 UTSW 14 51145507 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGTTCACGGGCTTGCATGAC -3'
(R):5'- ACAGTCTTGAGATTGGGGC -3'

Sequencing Primer
(F):5'- CGGGCTTGCATGACCCATTTG -3'
(R):5'- TGGCTGCAGGGACTAGG -3'
Posted On 2015-06-24