Mutagenetix > Incidental Mutation

Incidental Mutation 'R4275:Mapk8ip2'

324772

Institutional Source

Beutler Lab

Gene Symbol

Mapk8ip2

Ensembl Gene

ENSMUSG00000022619

Gene Name

mitogen-activated protein kinase 8 interacting protein 2

Synonyms

IB2, Jip2, 3230402N03Rik, JNK-interacting protein

MMRRC Submission

041646-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.507) question?

Stock #

R4275 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89453913-89464468 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89458995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 647 (W647R)

Ref Sequence

ENSEMBL: ENSMUSP00000023291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023291] [ENSMUST00000137755]

AlphaFold

Q9ERE9

Predicted Effect

probably damaging
Transcript: ENSMUST00000023291
AA Change: W647R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023291
Gene: ENSMUSG00000022619
AA Change: W647R

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	85	104	N/A	INTRINSIC
low complexity region	176	194	N/A	INTRINSIC
low complexity region	213	227	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	271	295	N/A	INTRINSIC
low complexity region	300	324	N/A	INTRINSIC
low complexity region	419	437	N/A	INTRINSIC
low complexity region	472	490	N/A	INTRINSIC
low complexity region	541	555	N/A	INTRINSIC
low complexity region	589	598	N/A	INTRINSIC
SH3	613	670	2.24e-10	SMART
PTB	684	823	1.19e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137755

Meta Mutation Damage Score

0.6190

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to MAPK8IP1/IB1/JIP-1, a scaffold protein that is involved in the c-Jun amino-terminal kinase signaling pathway. This protein is expressed in brain and pancreatic cells. It has been shown to interact with, and regulate the activity of MAPK8/JNK1, and MAP2K7/MKK7 kinases. This protein thus is thought to function as a regulator of signal transduction by protein kinase cascade in brain and pancreatic beta-cells. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele are smaller in size and exhibit male infertility. Mice homozygous for a different knock-out allele exhibit behavioral and cerebellar transmission deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1e	T	C	1: 154,493,325	Y322C	probably damaging	Het
Camsap2	A	G	1: 136,270,876	V1462A	probably benign	Het
D3Ertd751e	C	A	3: 41,756,154		probably benign	Het
Dhcr7	C	T	7: 143,843,227	A152V	probably damaging	Het
Enpep	A	T	3: 129,332,278	N68K	probably benign	Het
Fam126b	T	C	1: 58,529,933	T440A	probably benign	Het
Fam131b	G	A	6: 42,321,307	L43F	probably damaging	Het
Fbxl5	T	A	5: 43,762,772		probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Igf2	T	C	7: 142,655,786	M46V	probably benign	Het
Kntc1	T	A	5: 123,767,779	Y367N	probably damaging	Het
Mettl21c	C	T	1: 44,010,556	V110I	probably damaging	Het
Mrgprh	T	C	17: 12,877,227	L118P	probably damaging	Het
Myadm	A	G	7: 3,297,102	T127A	probably benign	Het
Myh10	A	T	11: 68,751,940		probably null	Het
Nadk	T	A	4: 155,584,255	Y128N	probably benign	Het
Olfr1089	T	C	2: 86,733,592	T7A	probably damaging	Het
Olfr996	T	C	2: 85,579,863	V208A	probably benign	Het
Papolg	A	G	11: 23,868,378	I500T	probably benign	Het
Pkhd1	A	T	1: 20,058,384	C4032S	probably benign	Het
Rnase1	A	T	14: 51,145,870	L9Q	probably damaging	Het
Rspry1	G	T	8: 94,649,761	V304L	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Scpep1	T	C	11: 88,947,142		probably null	Het
Serpina3m	T	A	12: 104,389,116	I14N	probably damaging	Het
Smg6	A	C	11: 74,993,874		probably benign	Het
Suz12	T	C	11: 80,030,053	M593T	probably damaging	Het
Tmem139	A	G	6: 42,264,105	E208G	probably damaging	Het
Tnxb	A	G	17: 34,698,231	Y2200C	probably damaging	Het
Usp19	T	G	9: 108,498,694	V911G	probably damaging	Het
Vipr1	T	C	9: 121,664,618	L245P	probably damaging	Het
Vmn2r105	T	A	17: 20,228,640	I92F	probably damaging	Het
Zfp518b	A	G	5: 38,671,728	V978A	probably damaging	Het
Zfp651	T	A	9: 121,766,539	V576D	probably damaging	Het

Other mutations in Mapk8ip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01942:Mapk8ip2	APN	15	89457017	critical splice donor site	probably null
IGL02720:Mapk8ip2	APN	15	89457582	missense	probably damaging	1.00
IGL02741:Mapk8ip2	APN	15	89457497	missense	probably damaging	1.00
IGL03027:Mapk8ip2	APN	15	89458107	missense	probably damaging	1.00
PIT4520001:Mapk8ip2	UTSW	15	89460697	missense	probably damaging	1.00
R0504:Mapk8ip2	UTSW	15	89456658	missense	possibly damaging	0.62
R2355:Mapk8ip2	UTSW	15	89458965	missense	probably benign	0.04
R3026:Mapk8ip2	UTSW	15	89461446	missense	probably damaging	1.00
R3430:Mapk8ip2	UTSW	15	89457282	missense	possibly damaging	0.86
R4789:Mapk8ip2	UTSW	15	89459038	missense	probably damaging	1.00
R4953:Mapk8ip2	UTSW	15	89457228	missense	probably benign
R5209:Mapk8ip2	UTSW	15	89459287	missense	probably damaging	1.00
R5417:Mapk8ip2	UTSW	15	89457439	missense	probably benign	0.16
R5521:Mapk8ip2	UTSW	15	89458804	missense	probably damaging	1.00
R6860:Mapk8ip2	UTSW	15	89460452	missense	probably damaging	1.00
R7145:Mapk8ip2	UTSW	15	89458998	missense	possibly damaging	0.67
R7231:Mapk8ip2	UTSW	15	89458076	missense	probably benign
R7369:Mapk8ip2	UTSW	15	89454251	missense	probably benign	0.01
R7753:Mapk8ip2	UTSW	15	89461653	missense	probably damaging	1.00
R7827:Mapk8ip2	UTSW	15	89458119	missense	probably damaging	0.98
R7834:Mapk8ip2	UTSW	15	89461373	missense	probably damaging	1.00
R8387:Mapk8ip2	UTSW	15	89460694	missense	probably damaging	1.00
R8433:Mapk8ip2	UTSW	15	89457866	missense	probably benign	0.01
R8528:Mapk8ip2	UTSW	15	89455219	missense	probably damaging	1.00
R9061:Mapk8ip2	UTSW	15	89457813	missense	possibly damaging	0.76
R9301:Mapk8ip2	UTSW	15	89457683	missense	probably damaging	1.00
R9768:Mapk8ip2	UTSW	15	89458957	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCTCTTGGCCAAGATGAC -3'
(R):5'- ACTGCACATCGAAGCGATCC -3'

Sequencing Primer
(F):5'- TTGGCCAAGATGACCCTTAG -3'
(R):5'- TCGAAGCGATCCACCCAG -3'

Posted On

2015-06-24