Incidental Mutation 'R4275:Mrgprh'
ID 324773
Institutional Source Beutler Lab
Gene Symbol Mrgprh
Ensembl Gene ENSMUSG00000059408
Gene Name MAS-related GPR, member H
Synonyms Gpr90, MrgH
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock # R4275 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 12876034-12877842 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12877227 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 118 (L118P)
Ref Sequence ENSEMBL: ENSMUSP00000074768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075296]
AlphaFold Q99MT8
Predicted Effect probably damaging
Transcript: ENSMUST00000075296
AA Change: L118P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074768
Gene: ENSMUSG00000059408
AA Change: L118P

DomainStartEndE-ValueType
Pfam:7tm_1 51 279 1.1e-12 PFAM
low complexity region 284 295 N/A INTRINSIC
Meta Mutation Damage Score 0.4200 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
Camsap2 A G 1: 136,270,876 V1462A probably benign Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Mrgprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02933:Mrgprh APN 17 12877709 missense probably damaging 1.00
R0358:Mrgprh UTSW 17 12877350 missense probably damaging 1.00
R0373:Mrgprh UTSW 17 12876956 missense possibly damaging 0.90
R1139:Mrgprh UTSW 17 12876942 missense probably benign 0.14
R1934:Mrgprh UTSW 17 12876951 missense probably damaging 0.96
R2169:Mrgprh UTSW 17 12876969 missense probably benign 0.02
R5193:Mrgprh UTSW 17 12877055 missense probably damaging 1.00
R5211:Mrgprh UTSW 17 12877002 missense probably benign 0.02
R5658:Mrgprh UTSW 17 12877759 missense possibly damaging 0.63
R5783:Mrgprh UTSW 17 12877446 missense probably benign 0.06
R6787:Mrgprh UTSW 17 12876987 missense probably benign
R6939:Mrgprh UTSW 17 12876935 missense probably benign 0.00
R8776:Mrgprh UTSW 17 12877488 missense probably benign 0.02
R8776-TAIL:Mrgprh UTSW 17 12877488 missense probably benign 0.02
R9019:Mrgprh UTSW 17 12877313 missense probably damaging 1.00
R9213:Mrgprh UTSW 17 12877030 missense probably damaging 1.00
R9601:Mrgprh UTSW 17 12877377 missense possibly damaging 0.46
Z1177:Mrgprh UTSW 17 12877587 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGGTCATTTGTTCCCTGGGAC -3'
(R):5'- GGGGCTTCACTTCCAGAATG -3'

Sequencing Primer
(F):5'- GGTTCCTAATCTTCTGTATCAAGAGG -3'
(R):5'- GGCTTCACTTCCAGAATGCAGAAG -3'
Posted On 2015-06-24