Incidental Mutation 'R4359:Olfr16'
ID324783
Institutional Source Beutler Lab
Gene Symbol Olfr16
Ensembl Gene ENSMUSG00000037924
Gene Nameolfactory receptor 16
SynonymsMOR23, MOR267-13, GA_x6K02T2R7CC-893157-892228
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4359 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172950409-172958357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 172957080 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 95 (A95E)
Ref Sequence ENSEMBL: ENSMUSP00000149249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038432] [ENSMUST00000215254]
Predicted Effect probably benign
Transcript: ENSMUST00000038432
AA Change: A95E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041524
Gene: ENSMUSG00000037924
AA Change: A95E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 7.5e-51 PFAM
Pfam:7tm_1 41 289 3.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215254
AA Change: A95E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cdc14b T A 13: 64,248,411 I15F probably benign Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifit2 A T 19: 34,573,144 D28V possibly damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Mindy3 A T 2: 12,396,209 W233R probably damaging Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Olfr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Olfr16 APN 1 172957591 missense possibly damaging 0.66
IGL00336:Olfr16 APN 1 172957478 missense probably benign 0.30
IGL01155:Olfr16 APN 1 172956924 missense probably benign 0.43
IGL01549:Olfr16 APN 1 172956974 missense probably damaging 1.00
IGL02679:Olfr16 APN 1 172957176 missense probably damaging 1.00
IGL03071:Olfr16 APN 1 172956935 missense probably benign 0.01
IGL03352:Olfr16 APN 1 172957283 missense probably benign 0.00
R0449:Olfr16 UTSW 1 172957398 missense probably damaging 1.00
R1725:Olfr16 UTSW 1 172957341 missense possibly damaging 0.90
R1726:Olfr16 UTSW 1 172957091 missense probably benign 0.00
R1735:Olfr16 UTSW 1 172956807 missense probably benign
R1928:Olfr16 UTSW 1 172957314 missense probably damaging 0.98
R4258:Olfr16 UTSW 1 172957638 missense possibly damaging 0.88
R4434:Olfr16 UTSW 1 172957544 missense probably damaging 1.00
R4666:Olfr16 UTSW 1 172957590 missense probably benign
R4874:Olfr16 UTSW 1 172957599 missense probably benign 0.00
R5063:Olfr16 UTSW 1 172957442 missense possibly damaging 0.48
R5988:Olfr16 UTSW 1 172957156 nonsense probably null
R6074:Olfr16 UTSW 1 172957378 missense probably benign 0.10
R7021:Olfr16 UTSW 1 172956927 missense probably benign 0.01
R7234:Olfr16 UTSW 1 172957106 missense probably damaging 0.96
R7527:Olfr16 UTSW 1 172956944 missense probably benign 0.00
R8271:Olfr16 UTSW 1 172957177 nonsense probably null
R8890:Olfr16 UTSW 1 172957478 missense probably benign 0.30
Z1088:Olfr16 UTSW 1 172957324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCATCAGATAACCCTCTTTGTG -3'
(R):5'- GGCTGGCACATGAAGAACTG -3'

Sequencing Primer
(F):5'- TACATTTTAACTCTGGCTGGCAAC -3'
(R):5'- TGCCATAACCAGGCCAGTG -3'
Posted On2015-07-06