Incidental Mutation 'R4359:Mindy3'
ID324784
Institutional Source Beutler Lab
Gene Symbol Mindy3
Ensembl Gene ENSMUSG00000026767
Gene NameMINDY lysine 48 deubiquitinase 3
Synonyms5830410F13Rik, 2310047O13Rik, 1810041E18Rik, Fam188a
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4359 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location12347263-12419470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12396209 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 233 (W233R)
Ref Sequence ENSEMBL: ENSMUSP00000028105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028105] [ENSMUST00000124515] [ENSMUST00000124603] [ENSMUST00000129489] [ENSMUST00000129993] [ENSMUST00000144645] [ENSMUST00000151529] [ENSMUST00000154899] [ENSMUST00000155530]
Predicted Effect probably damaging
Transcript: ENSMUST00000028105
AA Change: W233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028105
Gene: ENSMUSG00000026767
AA Change: W233R

DomainStartEndE-ValueType
DUF4205 9 351 1.48e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124515
SMART Domains Protein: ENSMUSP00000120193
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Blast:DUF4205 9 94 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124603
SMART Domains Protein: ENSMUSP00000117457
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 79 8.3e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129348
AA Change: W139R
SMART Domains Protein: ENSMUSP00000121265
Gene: ENSMUSG00000026767
AA Change: W139R

DomainStartEndE-ValueType
DUF4205 3 160 3.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129489
SMART Domains Protein: ENSMUSP00000122501
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 84 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129993
SMART Domains Protein: ENSMUSP00000141479
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 3 87 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137082
Predicted Effect probably benign
Transcript: ENSMUST00000144645
SMART Domains Protein: ENSMUSP00000116836
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 87 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153690
Predicted Effect probably benign
Transcript: ENSMUST00000154899
SMART Domains Protein: ENSMUSP00000121476
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 1 110 6.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155530
SMART Domains Protein: ENSMUSP00000116939
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 9 135 6.24e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195084
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a caspase-associated recruitment domain and may function in apoptosis. It has been identified as a tumor suppressor in lung and gastric cancers, and a polymorphism in the gene may be associated with gastric cancer risk. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cdc14b T A 13: 64,248,411 I15F probably benign Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifit2 A T 19: 34,573,144 D28V possibly damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr16 C A 1: 172,957,080 A95E probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Mindy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Mindy3 APN 2 12355272 splice site probably benign
IGL02623:Mindy3 APN 2 12364483 nonsense probably null
R0944:Mindy3 UTSW 2 12396182 missense possibly damaging 0.94
R1275:Mindy3 UTSW 2 12396173 splice site probably null
R2066:Mindy3 UTSW 2 12419249 missense probably damaging 1.00
R2232:Mindy3 UTSW 2 12404045 missense probably benign 0.44
R2357:Mindy3 UTSW 2 12404176 splice site probably benign
R3724:Mindy3 UTSW 2 12355354 missense probably damaging 0.97
R4031:Mindy3 UTSW 2 12401083 splice site probably null
R4089:Mindy3 UTSW 2 12364516 missense probably benign 0.21
R4175:Mindy3 UTSW 2 12405865 missense probably damaging 1.00
R4424:Mindy3 UTSW 2 12348199 missense probably benign 0.00
R4640:Mindy3 UTSW 2 12348163 missense probably benign 0.01
R4931:Mindy3 UTSW 2 12396213 missense probably damaging 1.00
R5926:Mindy3 UTSW 2 12348100 missense probably damaging 1.00
R5966:Mindy3 UTSW 2 12401043 missense probably benign 0.17
R6330:Mindy3 UTSW 2 12356933 missense probably damaging 1.00
R6518:Mindy3 UTSW 2 12382129 missense probably damaging 1.00
R6587:Mindy3 UTSW 2 12348116 nonsense probably null
R6852:Mindy3 UTSW 2 12419252 start codon destroyed possibly damaging 0.53
R6961:Mindy3 UTSW 2 12396178 critical splice donor site probably null
R7103:Mindy3 UTSW 2 12401074 missense possibly damaging 0.95
R7624:Mindy3 UTSW 2 12419189 missense probably benign 0.00
R7661:Mindy3 UTSW 2 12397517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCACTTAGTATTATGGCATC -3'
(R):5'- TGTAGCTCTCACTAAGGCCG -3'

Sequencing Primer
(F):5'- ATTATGGCATCTTAGAAACCGTAAG -3'
(R):5'- TCTCACTAAGGCCGGACATG -3'
Posted On2015-07-06