Incidental Mutation 'R4359:Ifna15'
ID 324790
Institutional Source Beutler Lab
Gene Symbol Ifna15
Ensembl Gene ENSMUSG00000096011
Gene Name interferon alpha 15
Synonyms Ifnaa, Gm12597
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4359 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 88557673-88558245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 88557842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 135 (T135N)
Ref Sequence ENSEMBL: ENSMUSP00000099873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102809]
AlphaFold Q61718
Predicted Effect probably benign
Transcript: ENSMUST00000102809
AA Change: T135N

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099873
Gene: ENSMUSG00000096011
AA Change: T135N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 2.97e-68 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cdc14b T A 13: 64,248,411 I15F probably benign Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifit2 A T 19: 34,573,144 D28V possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Mindy3 A T 2: 12,396,209 W233R probably damaging Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr16 C A 1: 172,957,080 A95E probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Ifna15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Ifna15 APN 4 88557807 missense probably damaging 1.00
IGL01757:Ifna15 APN 4 88558085 missense possibly damaging 0.79
IGL01824:Ifna15 APN 4 88557783 missense probably benign 0.00
R3853:Ifna15 UTSW 4 88557809 missense probably damaging 1.00
R4356:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4357:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4358:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R5038:Ifna15 UTSW 4 88558029 missense probably benign 0.03
R5372:Ifna15 UTSW 4 88558101 missense probably damaging 0.97
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R7347:Ifna15 UTSW 4 88557983 missense probably damaging 1.00
R8097:Ifna15 UTSW 4 88557701 missense probably benign 0.01
R8132:Ifna15 UTSW 4 88557683 missense possibly damaging 0.60
R8824:Ifna15 UTSW 4 88557761 missense probably damaging 1.00
R9349:Ifna15 UTSW 4 88558046 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGAGAGATAGAGTCCTCATTCAGG -3'
(R):5'- TGCCCAGCAGATCCAGAATG -3'

Sequencing Primer
(F):5'- GAGTCCTCTCTACTTTGTCTCAGGAC -3'
(R):5'- GAATGCTCAAGCCATCCCTGTC -3'
Posted On 2015-07-06