Incidental Mutation 'R4359:Srd5a3'
ID324793
Institutional Source Beutler Lab
Gene Symbol Srd5a3
Ensembl Gene ENSMUSG00000029233
Gene Namesteroid 5 alpha-reductase 3
SynonymsD730040M03Rik, 1110025P14Rik, Srd5a2l
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4359 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76140271-76155504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76147700 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 79 (F79Y)
Ref Sequence ENSEMBL: ENSMUSP00000031143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031143] [ENSMUST00000113506] [ENSMUST00000113507] [ENSMUST00000127278] [ENSMUST00000152642]
Predicted Effect probably damaging
Transcript: ENSMUST00000031143
AA Change: F79Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031143
Gene: ENSMUSG00000029233
AA Change: F79Y

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 132 150 N/A INTRINSIC
Pfam:Steroid_dh 168 330 4.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113506
SMART Domains Protein: ENSMUSP00000109134
Gene: ENSMUSG00000029233

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Steroid_dh 44 206 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113507
SMART Domains Protein: ENSMUSP00000109135
Gene: ENSMUSG00000029233

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Steroid_dh 44 206 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127278
SMART Domains Protein: ENSMUSP00000116801
Gene: ENSMUSG00000029233

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138699
Predicted Effect probably benign
Transcript: ENSMUST00000152642
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the steroid 5-alpha reductase family, and polyprenol reductase subfamily. It is involved in the production of androgen 5-alpha-dihydrotestosterone (DHT) from testosterone, and maintenance of the androgen-androgen receptor activation pathway. This protein is also necessary for the conversion of polyprenol into dolichol, which is required for the synthesis of dolichol-linked monosaccharides and the oligosaccharide precursor used for N-linked glycosylation of proteins. Mutations in this gene are associated with congenital disorder of glycosylation type Iq. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E11.5 and E13.5 with open neural tubes, failure to turn, dilated hearts, and ventral body wall defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cdc14b T A 13: 64,248,411 I15F probably benign Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifit2 A T 19: 34,573,144 D28V possibly damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Mindy3 A T 2: 12,396,209 W233R probably damaging Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr16 C A 1: 172,957,080 A95E probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Srd5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Srd5a3 APN 5 76149746 splice site probably benign
IGL02172:Srd5a3 APN 5 76147709 missense probably benign 0.05
R1055:Srd5a3 UTSW 5 76153638 missense probably benign 0.30
R1777:Srd5a3 UTSW 5 76149783 missense probably damaging 0.96
R1914:Srd5a3 UTSW 5 76147705 missense probably benign
R1915:Srd5a3 UTSW 5 76147705 missense probably benign
R4357:Srd5a3 UTSW 5 76147700 missense probably damaging 0.99
R4537:Srd5a3 UTSW 5 76149951 critical splice donor site probably null
R5714:Srd5a3 UTSW 5 76153566 missense probably benign 0.06
R6762:Srd5a3 UTSW 5 76153551 missense probably benign
R7009:Srd5a3 UTSW 5 76149866 missense probably benign 0.00
R7130:Srd5a3 UTSW 5 76149837 missense possibly damaging 0.87
R7185:Srd5a3 UTSW 5 76153572 missense probably benign 0.09
R7427:Srd5a3 UTSW 5 76154643 missense probably benign 0.00
R7778:Srd5a3 UTSW 5 76154771 missense probably damaging 0.99
R7824:Srd5a3 UTSW 5 76154771 missense probably damaging 0.99
Z1088:Srd5a3 UTSW 5 76149821 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGACCATTCTTGTTACCCAG -3'
(R):5'- CCTGCAGAGGGACATGATTG -3'

Sequencing Primer
(F):5'- GGACCATTCTTGTTACCCAGAAACAG -3'
(R):5'- CATGATTGGTGAGAACACGAAC -3'
Posted On2015-07-06