Incidental Mutation 'R4359:Grm7'
ID324798
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Nameglutamate receptor, metabotropic 7
SynonymsGpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4359 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location110645581-111567230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110646348 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 161 (V161F)
Ref Sequence ENSEMBL: ENSMUSP00000134635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
Predicted Effect probably damaging
Transcript: ENSMUST00000071076
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: V161F

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172951
AA Change: V161F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: V161F

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173609
Predicted Effect probably damaging
Transcript: ENSMUST00000174018
AA Change: V161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: V161F

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Meta Mutation Damage Score 0.2357 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cdc14b T A 13: 64,248,411 I15F probably benign Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifit2 A T 19: 34,573,144 D28V possibly damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lpcat2 C A 8: 92,873,106 P234Q probably benign Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Mindy3 A T 2: 12,396,209 W233R probably damaging Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr16 C A 1: 172,957,080 A95E probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
Appropriated UTSW 6 111495681 missense possibly damaging 0.64
Consumed UTSW 6 111358875 missense probably damaging 1.00
Devoured UTSW 6 111358824 missense probably damaging 1.00
shaky UTSW 6 111495791 nonsense probably null
PIT4651001:Grm7 UTSW 6 110646089 missense probably benign
R0539:Grm7 UTSW 6 111359094 splice site probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1823:Grm7 UTSW 6 111207769 missense probably benign 0.17
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2138:Grm7 UTSW 6 110646137 missense probably damaging 1.00
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
R7076:Grm7 UTSW 6 111358152 missense probably benign 0.04
R7203:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7208:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7217:Grm7 UTSW 6 111358824 missense probably damaging 1.00
R7257:Grm7 UTSW 6 110646118 missense probably damaging 1.00
R7297:Grm7 UTSW 6 110646013 missense probably benign 0.16
R7470:Grm7 UTSW 6 111501515 missense
R7567:Grm7 UTSW 6 111358761 missense probably damaging 0.96
R7806:Grm7 UTSW 6 111246353 nonsense probably null
R8018:Grm7 UTSW 6 111207776 missense probably benign 0.01
Z1176:Grm7 UTSW 6 111358149 missense probably benign 0.01
Z1176:Grm7 UTSW 6 111358490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCGACCAGATCAACAG -3'
(R):5'- TTCGACAGGATCTCCAGGGTAG -3'

Sequencing Primer
(F):5'- TGCTGCCCAACGTAACG -3'
(R):5'- ATCTCCAGGGTAGAAATGTTGG -3'
Posted On2015-07-06